Anthophora ursina

Cresson, 1869 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records873

Data sources7

Biological traits1

DNA specimens39

eDNA detections51

Sources7 archives

Databases and archives Anthophora ursina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility873 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF873 records

Environmental DNA1 datasets · 2 countries51 detections

DNA & barcodingBOLD39 specimens

01Narrative

Anthophora ursina is a species of anthophorine bee in the family Apidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)3.57 mm

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora ursina has left across the world's sequence archives.

At a glance

DNA specimens39

BINs3

Marker genes1

eDNA detections51

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

1Amostly conserved

4Gmostly conserved

14Tmostly conserved

55Gmostly conserved

80Amostly conserved

88Tmostly conserved

130Tmostly conserved

145Gmostly conserved

158Tmostly conserved

163Tmostly conserved

208Gmostly conserved

211Gmostly conserved

217Amostly conserved

218Gmostly conserved

268Gmostly conserved

496Gmostly conserved

526Gmostly conserved

539Cmostly conserved

631Gmostly conserved

AATGATTTATTTTTTATTTGCTTTATGAGCAGGTATAATTGGTACTTCTATAAGGATAATTATTCGTATAGAATTAAGAACTCCAGGTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes5

BINs3

Most divergent pair8.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora vannigerasame genus7.9%Anthophora hispanicasame genus8.4%Anthophora crinipessame genus8.8%Anthophora fulvitarsissame genus8.9%Anthophora mucidasame genus8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type873 records

Wild obs. + sensor44

Museum / vouchered829

Range

Area of Occupancy AOO1 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 23≤1 km 6≤10 km 3>10 km 5

37 georeferenced · 7 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 13≤1 km 10≤10 km 76>10 km 20

119 georeferenced · 710 without coordinates

Open the institutions mapphysical evidence829

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	435
Oregon State Arthropod Collectionlocation not on record	82
Champaign, US	49
North Carolina State University Insect Museumlocation not on record	45
Colorado State Universitylocation not on record	45
Wuzhou, CN	41
	37
Nelson, CA	20
Weber State University, Bird and Mammal Collectionlocation not on record	12
Natural History Museum of Utahlocation not on record	8
Alberta Environment and Parkslocation not on record	8
OSUClocation not on record	7
Universidad Católica de Manizaleslocation not on record	7
WIlocation not on record	5
US	4
Cambridge, US	4
University of Central Floridalocation not on record	4
ASUlocation not on record	3
Awka, NG	2
University of Alabamalocation not on record	2
Mississippi State, US	1
CUlocation not on record	1
New Haven, US	1
UNHClocation not on record	1
WSUClocation not on record	1
University Park, US	1

26 institutions · 826 of 829 vouchered records shown · 3 without an institution code

09Environmental DNA51 detections

Where the DNA of Anthophora ursina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate Grassland1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 8.80–16.4

Seasonal swing summer↔winter24.4 °C

Max temp (day)18.5 °C 14.1–22.6

Min temp (night)4.70 °C 2.10–10.0

Precipitation44.8 mm/mo 26.2–95.3

Air humidity51.4 % 42.9–54.0

Moisture balance-90.3 mm/mo -130–-12.0

Vapour deficit742 Pa 572–883

Wind speed2.90 m/s 1.20–5.70

Cloud cover38.4 % 31.1–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)