Anthophora centriformis

Cresson, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Anthophora

At a glance

Occurrence records431

Data sources7

Biological traits1

DNA specimens10

eDNA detections9

Sources7 archives

Databases and archives Anthophora centriformis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility431 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF431 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD10 specimens

01Narrative

Anthophora centriformis is a species of anthophorine bee in the family Apidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)4.23 mm

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthophora centriformis has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

331Amostly conserved

334Avariable

343Tmostly conserved

364Cmostly conserved

388Amostly conserved

574Tmostly conserved

625Tmostly conserved

AATAATTTATTTTATTTTTTCATTATGATCAGGTATAGTTGGAACTTCAATAAGTATAATTATTCGAATAGAATTGAGTTCTCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.28%

Haplotypes3

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora quadrimaculatasame genus11.4%Anthophora plagiatasame genus11.6%Anthophora dufouriisame genus12.1%Anthophora leucophaeasame genus12.1%Anthophora bomboidessame genus12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type431 records

Wild obs. + sensor12

Museum / vouchered418

Other1

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 4≤1 km 7>10 km 1

12 georeferenced

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 1≤10 km 6>10 km 11

18 georeferenced · 400 without coordinates

Open the institutions mapphysical evidence418

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	270
Wuzhou, CN	71
	20
University of Central Floridalocation not on record	17
University of Alabamalocation not on record	16
San Diego, US	14
ASUlocation not on record	3
Chicago, US	2
Cambridge, US	1
Albuquerque, US	1
College Station, US	1
OSUClocation not on record	1
Mexico City, MX	1

13 institutions · 418 of 418 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Anthophora centriformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 17.4–25.4

Seasonal swing summer↔winter19.5 °C

Max temp (day)28.4 °C 23.8–32.9

Min temp (night)13.9 °C 10.9–17.7

Precipitation5.30 mm/mo 2.40–41.2

Air humidity45.0 % 43.3–58.5

Moisture balance-157 mm/mo -201–-103

Vapour deficit1,391 Pa 835–1,838

Wind speed4.00 m/s 3.00–5.30

Cloud cover28.6 % 19.4–33.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)