Anthonomus rubi

L.Bedel, 1887 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Anthonomus

At a glance

Occurrence records5 130

Data sources7

Biological traits0

DNA specimens126

eDNA detections20

Sources7 archives

Databases and archives Anthonomus rubi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 130 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics126 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 130 records

Environmental DNA1 datasets · 5 countries20 detections

DNA & barcodingBOLD126 specimens

Genome at a glanceGoaT · NCBI≈386 Mbp

01Narrative

Anthonomus rubi ou curcu noir à longue trompe est une espèce d'insectes coléoptères de la famille des Curculionidae (charançons) ravageuse pour les boutons de fraisiers et de framboisiers dont elle se nourrit. Les adultes se nourrissent de leur feuillage et les femelles pondent un œuf par bouton donnant naissance au bout de six à sept jours à une larve qui s'en nourrit au printemps pendant vingt-six jours. L'insecte peut ainsi causer la perte de 80 % de la récolte dans certains cas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding126 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthonomus rubi has left across the world's sequence archives.

At a glance

DNA specimens126

BINs3

Marker genes2

eDNA detections20

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus114 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

22Gmostly conserved

52Cmostly conserved

61Tmostly conserved

73Amostly conserved

81Gvariable

82Cmostly conserved

92Tmostly conserved

122Amostly conserved

124Tmostly conserved

145Cvariable

181Tmostly conserved

214Gvariable

235Cvariable

308Gmostly conserved

331Amostly conserved

337Amostly conserved

340Cmostly conserved

343Avariable

361Gvariable

364Tmostly conserved

370Amostly conserved

421Tvariable

455Amostly conserved

473Tvariable

475Amostly conserved

476Amostly conserved

490Gmostly conserved

499Cmostly conserved

500Cmostly conserved

506Amostly conserved

527Avariable

565Gmostly conserved

577Amostly conserved

589Cmostly conserved

601Tmostly conserved

628Amostly conserved

631Gvariable

634Tmostly conserved

AACTTTATATTTTATTTTTGGGGCCTGATCAGGGGCCGTTGGAACTTCTCTCAGTATACTTATTCGAACAGAACTAGGAAGCCCCGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes24

BINs3

Most divergent pair4.9%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Brachonyx pinetisame family16.0%Anthonomus pomorumsame genus16.3%Anthonomus humeralissame genus16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_044714 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anthonomus rubi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈385 683 110 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anthonomus rubi0.39 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type5 130 records

Wild obs. + sensor4 611

Museum / vouchered502

Cultivated / captive4

Fossil13

Range

Area of Occupancy AOO13 344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 2 184≤1 km 1 206≤10 km 431>10 km 89

3 910 georeferenced · 701 without coordinates

Open the mapobservation + sensor4 611

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 235≤1 km 172≤10 km 25>10 km 3

435 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence502

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
SLU Artdatabankenlocation not on record	346
NMBU:MINAlocation not on record	69
ZSMlocation not on record	11
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	6
Agriculture and Agri-Food Canada, Agassiz Research and Development Centrelocation not on record	4
Natural History Museum, Londonlocation not on record	3
Wellcome Sanger Institutelocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Norwegian University of Life Sciences (NMBU)location not on record	1

9 institutions · 442 of 502 vouchered records shown · 59 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA20 detections

Where the DNA of Anthonomus rubi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 10.3–17.2

Seasonal swing summer↔winter13.3 °C

Max temp (day)19.2 °C 14.5–21.5

Min temp (night)11.6 °C 6.70–14.2

Precipitation65.7 mm/mo 47.4–100

Air humidity63.5 % 61.3–64.9

Moisture balance-13.5 mm/mo -94.4–-0.3

Vapour deficit575 Pa 553–715

Wind speed3.10 m/s 1.60–4.20

Cloud cover50.1 % 31.4–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthonomus rubi

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 130 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 130 records