Anthomyia procellaris

Rondani, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Anthomyiidae/Anthomyia

At a glance

Occurrence records7 564

Data sources7

Biological traits0

DNA specimens44

eDNA detections12

Sources7 archives

Databases and archives Anthomyia procellaris's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 564 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 564 records

Environmental DNA2 datasets · 2 countries12 detections

DNA & barcodingBOLD44 specimens

01Narrative

Anthomyia procellaris is a species of fly in the family Anthomyiidae.Catalogue of life

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthomyia procellaris has left across the world's sequence archives.

At a glance

DNA specimens44

BINs2

Marker genes2

eDNA detections12

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

22Amostly conserved

25Tmostly conserved

148Gmostly conserved

316Gvariable

403Tmostly conserved

466Amostly conserved

616Tmostly conserved

634Tmostly conserved

646Tmostly conserved

TACTTTATATTTTATTTTTGGAGCTTGAGCAGGAATAGTAGGAACTTCTTTAAGTATTCTAATTCGAGCAGAATTAGGACATCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes9

BINs2

Most divergent pair6.5%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthomyia imbridasame genus5.6%Anthomyia oculiferasame genus5.9%Anthomyia plurinotatasame genus6.1%Anthomyia pluvialissame genus6.3%Scathophaga stercorariasame order6.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type7 564 records

Wild obs. + sensor7 413

Museum / vouchered151

Range

Area of Occupancy AOO12 424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 1 936≤1 km 1 098≤10 km 3 826>10 km 48

6 908 georeferenced · 505 without coordinates

Open the mapobservation + sensor7 413

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 103≤1 km 21≤10 km 7

131 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence151

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DFFW2016location not on record	11
Helsinki, FI	10
SLU Artdatabankenlocation not on record	10
Metsähallituslocation not on record	7
SGAV-and-NHMDlocation not on record	6
University of Tokyo, Department of Zoologylocation not on record	6
DFFW2018location not on record	5
Washington, US	5
South Kensington, GB	5
Gothenburg, SE	4
Stockholm, SE	3
CBDClocation not on record	3
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	3
neflocation not on record	3
NHMOlocation not on record	2
MZLUlocation not on record	2
ZMAAlocation not on record	2
Copenhagen, DK	1
Champaign, US	1

19 institutions · 89 of 151 vouchered records shown · 62 without an institution code

09Environmental DNA12 detections

Where the DNA of Anthomyia procellaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 14.2–14.7

Seasonal swing summer↔winter15.7 °C

Max temp (day)17.6 °C 16.5–18.5

Min temp (night)10.8 °C 10.6–12.0

Precipitation66.3 mm/mo 62.9–69.8

Air humidity60.5 % 59.9–60.9

Moisture balance-60.9 mm/mo -69.0–-45.4

Vapour deficit650 Pa 642–671

Wind speed4.60 m/s 4.20–6.00

Cloud cover43.5 % 39.1–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthomyia procellaris

At a glance

Sources7 archives

At a glance

Record type7 564 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 564 records