Anthomyia pluvialis

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Anthomyiidae/Anthomyia

At a glance

Occurrence records1 708

Data sources7

Biological traits0

DNA specimens360

eDNA detections1 806

Sources7 archives

Databases and archives Anthomyia pluvialis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 708 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 806 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics360 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 708 records

Environmental DNA5 datasets · 15 countries1 806 detections

DNA & barcodingBOLD360 specimens

01Narrative

Anthomyia pluvialis is a species of fly in the family Anthomyiidae. It is found in the Palearctic.Fauna Europaea

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding360 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthomyia pluvialis has left across the world's sequence archives.

At a glance

DNA specimens360

BINs4

Marker genes2

eDNA detections1 806

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus347 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 47 variable positions, in barcode order

2Amostly conserved

20Gmostly conserved

23Amostly conserved

38Gmostly conserved

48Cmostly conserved

56Tmostly conserved

68Tmostly conserved

77Amostly conserved

80Tmostly conserved

83Tmostly conserved

86Amostly conserved

131Cmostly conserved

164Amostly conserved

179Amostly conserved

182Amostly conserved

185Cmostly conserved

188Gmostly conserved

203Tmostly conserved

206Amostly conserved

210Cmostly conserved

233Tmostly conserved

269Amostly conserved

272Tmostly conserved

314Amostly conserved

338Cmostly conserved

341Amostly conserved

344Amostly conserved

353Tmostly conserved

365Tmostly conserved

371Amostly conserved

377Amostly conserved

401Amostly conserved

413Gmostly conserved

419Tmostly conserved

426Tmostly conserved

434Cmostly conserved

449Tmostly conserved

470Tmostly conserved

482Cmostly conserved

488Tmostly conserved

531Cmostly conserved

536Gmostly conserved

554Amostly conserved

566Amostly conserved

576Tmostly conserved

587Tmostly conserved

614Tmostly conserved

CATTATATTTTATTTTTGGGGCATGAGCAGGAATAGTGGGAACTTCTCTAAGTATTCTAATTCGAGCTGAATTAGGACATCCTGGAGCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes33

BINs4

Most divergent pair13.0%

AsiaEuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthomyia procellarissame genus6.3%Anthomyia imbridasame genus6.6%Botanophila sericeasame family7.2%Pegomya maculatasame family7.2%Hylemyza partitasame family7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 708 records

Wild obs. + sensor1 482

Museum / vouchered225

Cultivated / captive1

Range

Area of Occupancy AOO4 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 585≤1 km 422≤10 km 120>10 km 20

1 147 georeferenced · 335 without coordinates

Open the mapobservation + sensor1 482

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 31≤1 km 31≤10 km 63>10 km 2

127 georeferenced · 98 without coordinates

Open the institutions mapphysical evidence225

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NCMGlocation not on record	42
University of Guelph, Centre for Biodiversity Genomicslocation not on record	21
Champaign, US	16
Stockholm, SE	13
Tilburg, NL	9
University of Tokyo, Department of Zoologylocation not on record	8
CBDClocation not on record	7
ZMAAlocation not on record	7
IMEDEAlocation not on record	6
SLU Artdatabankenlocation not on record	5
Biodiversity Institute of Ontariolocation not on record	4
Helsinki, FI	4
DFFW2016location not on record	3
Gothenburg, SE	2
Metsähallituslocation not on record	2
South Kensington, GB	2
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	2
MZLUlocation not on record	2
DFlocation not on record	1
Philadelphia, US	1
CIBIOlocation not on record	1
Tromsø, NO	1

22 institutions · 159 of 225 vouchered records shown · 63 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 806 detections

Where the DNA of Anthomyia pluvialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 806

Studies independent surveys5

Countries15

Verifiable raw sequence linked1 527

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 806 detections have coordinates

Open the map15 countries0

1. Forest|1.4. Forest - TemperateForest14. Artificial - Terrestrial|14.5 Urban Areas1. Forest & Woodland|1.4. Temperate ForestGrasslandMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 10.6–17.4

Seasonal swing summer↔winter18.3 °C

Max temp (day)19.1 °C 14.9–21.4

Min temp (night)11.5 °C 6.20–13.8

Precipitation71.1 mm/mo 40.7–99.6

Air humidity59.3 % 56.3–61.8

Moisture balance-37.7 mm/mo -83.1–-3.70

Vapour deficit698 Pa 529–828

Wind speed2.80 m/s 2.40–4.10

Cloud cover48.1 % 37.3–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 1 804 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthomyia pluvialis

At a glance

Sources7 archives

At a glance

Record type1 708 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 708 records