Anthomyia liturata

Robineau-Desvoidy, 1830 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Anthomyiidae/Anthomyia

At a glance

Occurrence records2 361

Data sources6

Biological traits0

DNA specimens167

eDNA detections541

Sources6 archives

Databases and archives Anthomyia liturata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 361 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI541 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics167 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 361 records

Environmental DNA5 datasets · 6 countries541 detections

DNA & barcodingBOLD167 specimens

01Narrative

Anthomyia liturata is een vliegensoort uit de familie van de bloemvliegen (Anthomyiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1830 door Robineau-Desvoidy.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding167 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthomyia liturata has left across the world's sequence archives.

At a glance

DNA specimens167

BINs2

Marker genes2

eDNA detections541

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus152 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

38Gvariable

182Amostly conserved

210Cvariable

233Cmostly conserved

257Tmostly conserved

285Tvariable

338Cmostly conserved

344Cmostly conserved

368Avariable

410Cmostly conserved

482Tmostly conserved

488Tmostly conserved

542Amostly conserved

560Tvariable

587Cvariable

632Tmostly conserved

CATTATATTTTATTTTTGGAGCATGAGCAGGAATAGTGGGAACTTCTTTAAGAATTTTAATTCGAGCTGAATTAGGACATCCTGGAGCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes18

BINs2

Most divergent pair2.4%

EuropeAsiaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthomyia confusaneasame genus1.5%Anthomyia punctipennissame genus5.5%Egle pilitibiasame family5.5%Botanophila biseriatasame family5.7%Eutrichota tunicatasame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S

animal barcoderibosomal

08Occurrence & distribution

Record type2 361 records

Wild obs. + sensor2 194

Museum / vouchered145

Cultivated / captive22

Range

Area of Occupancy AOO4 736 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 1 315≤1 km 691≤10 km 171>10 km 1

2 178 georeferenced · 16 without coordinates

Open the mapobservation + sensor2 194

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 77≤1 km 20≤10 km 21>10 km 3

121 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence145

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the mapnot free-living22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	21
Stockholm, SE	12
University of Tokyo, Department of Zoologylocation not on record	12
Helsinki, FI	11
Tromsø, NO	10
DFFW2016location not on record	8
SLU Artdatabankenlocation not on record	8
DFFW2018location not on record	5
SGAV-and-NHMDlocation not on record	3
DFlocation not on record	3
CBDClocation not on record	3
Metsähallituslocation not on record	3
neflocation not on record	3
MZLUlocation not on record	2
NHMOlocation not on record	2
Gothenburg, SE	1
Durban Natural Science Museumlocation not on record	1
University of Genevalocation not on record	1
Wellcome Sanger Institutelocation not on record	1
Copenhagen, DK	1
Bavarian State Collection of Zoologylocation not on record	1

21 institutions · 112 of 145 vouchered records shown · 33 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA541 detections

Where the DNA of Anthomyia liturata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found541

Studies independent surveys5

Countries6

Verifiable raw sequence linked510

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 541 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 10.5–17.2

Seasonal swing summer↔winter18.3 °C

Max temp (day)18.6 °C 14.8–20.9

Min temp (night)11.5 °C 6.20–13.8

Precipitation67.8 mm/mo 43.4–93.8

Air humidity60.5 % 58.0–62.2

Moisture balance-40.3 mm/mo -66.1–0.6

Vapour deficit683 Pa 529–780

Wind speed3.30 m/s 2.50–4.50

Cloud cover46.0 % 39.8–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 541 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthomyia liturata

At a glance

Sources6 archives

At a glance

Record type2 361 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 361 records