Anthomyia punctipennis

Wiedemann, 1830 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Anthomyiidae/Anthomyia

At a glance

Occurrence records1 071

Data sources5

Biological traits0

DNA specimens3

eDNA detections72

Sources5 archives

Databases and archives Anthomyia punctipennis's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 071 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI72 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 071 records

Environmental DNA1 datasets · 3 countries72 detections

DNA & barcodingBOLD3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthomyia punctipennis has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections72

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.30%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

530Cvariable

532Avariable

631Tvariable

AACATTATATTTTATTTTTGGAGCATGAGCAGGAATAGTAGGAACTTCTTTAAGTATTTTAATTCGAGCTGAATTAGGACATCCCGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lasiomma atricaudumsame family5.1%Anthomyia confusaneasame genus5.2%Lasiomma picipessame family5.3%Hylemyza partitasame family5.3%Pegomya notabilissame family5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 071 records

Wild obs. + sensor897

Museum / vouchered174

Origin

Native9

Introduced1

Range

Area of Occupancy AOO2 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 417≤1 km 150≤10 km 64>10 km 127

758 georeferenced · 139 without coordinates

Open the mapobservation + sensor897

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 3≤1 km 12≤10 km 72

87 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	87
UFPRlocation not on record	61
Auckland, NZ	19
UE-05474location not on record	2
Tasmanian Museum & Art Gallerylocation not on record	2
MWLRlocation not on record	1
DPIlocation not on record	1

7 institutions · 173 of 174 vouchered records shown · 1 without an institution code

09Environmental DNA72 detections

Where the DNA of Anthomyia punctipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found72

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 72 detections have coordinates

Open the map3 countries0

14. Artificial - Terrestrial|14.5 Urban Areas1. Forest & Woodland|1.6. Subtropical/Tropic…14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 13.1–22.8

Seasonal swing summer↔winter13.8 °C

Max temp (day)24.4 °C 18.8–27.9

Min temp (night)14.2 °C 8.50–17.4

Precipitation92.4 mm/mo 25.0–152

Air humidity56.8 % 51.1–59.7

Moisture balance-28.0 mm/mo -142–-0.2

Vapour deficit939 Pa 634–1,238

Wind speed2.70 m/s 2.00–4.20

Cloud cover35.5 % 16.9–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 70 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthomyia punctipennis

At a glance

Sources5 archives

At a glance

Record type1 071 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 071 records