Antholoba achates

(Drayton, 1846) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Actiniaria/Actinostolidae/Antholoba

At a glance

Occurrence records1 767

Data sources6

Biological traits4

DNA specimens16

eDNA detections7

Sources6 archives

Databases and archives Antholoba achates's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 580 records↗

OBISOcean Biodiversity Information System187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 767 records

Environmental DNA2 datasets · 2 countries7 detections

DNA & barcodingBOLD16 specimens

01Narrative

Antholoba achates is een zeeanemonensoort uit de familie Antholobidae. De soort werd voor het eerst wetenschappelijk beschreven door Drayton in Dana in 1846.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max327 m

Depth min0 m

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antholoba achates has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes12

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATCTAATCTTTGGAATAGGATCTGGTATGATCGGCACAGCTTTAAGTATGTTAATAAGATTGGAGTTATCTGCCCCTGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hormathia nodosasame order7.4%Actinauge cristatasame order7.9%Hormathia digitatasame order8.0%Calliactis polypussame order8.1%Stephanauge nexilissame order8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_027611 ↗ · 15 protein · 2 tRNA · 2 rRNA

COX3COX1homing endonucleaseND4LATP8ATP6ND5ND1ND3ND2COX2ORFAND4ND6CYTB16S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 767 records

Wild obs. + sensor1 656

Museum / vouchered63

Other48

Origin

Native2

Range

Area of Occupancy AOO868 km²

Depth

0–200 m sunlit115

200–1000 m twilight9

1–4 km midnight0

>4 km abyssal0

median 7.2 m · max 254.5 m · 124 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 214≤1 km 53≤10 km 63>10 km 8

338 georeferenced · 1 318 without coordinates

Open the mapobservation + sensor1 656

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 6

7 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence63

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	22
Washington, US	7
Universidad Católica del Nortelocation not on record	5
	4
fcnym.unlp.edu.arlocation not on record	3
Museo de Zoología de la Universidad de Concepción (UCCC_MZUC)location not on record	2
CASlocation not on record	2
ARMS-MBONlocation not on record	1
Buenos Aires, AR	1
Cambridge, US	1
University of Oslo (UiO)location not on record	1
Auckland, NZ	1
MZLUlocation not on record	1

13 institutions · 51 of 63 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Antholoba achates was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

Research site; semi-industrial; 9.5 - Subtid…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median3.60 °C 3.60–17.9

Seasonal swing summer↔winter9.50 °C

Max temp (day)6.40 °C 6.40–19.7

Min temp (night)-0.2 °C -0.2–15.6

Precipitation97.3 mm/mo 92.9–97.3

Air humidity68.4 % 60.5–68.4

Moisture balance26.5 mm/mo -28.9–26.5

Vapour deficit250 Pa 250–971

Wind speed9.10 m/s 4.50–9.10

Cloud cover28.0 % 28.0–33.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antholoba achates

At a glance

Sources6 archives

Habitat & environment2

Other traits2

At a glance

Record type1 767 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 767 records