Actinauge cristata

Riemann-Zürneck, 1986 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Actiniaria/Hormathiidae/Actinauge

At a glance

Occurrence records1 680

Data sources7

Biological traits4

DNA specimens11

eDNA detections596

Sources7 archives

Databases and archives Actinauge cristata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility847 records↗

OBISOcean Biodiversity Information System833 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI596 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 680 records

Environmental DNA3 datasets · 1 countries596 detections

DNA & barcodingBOLD11 specimens

01Narrative

Actinauge cristata is een zeeanemonensoort uit de familie Hormathiidae. Actinauge cristata is voor het eerst wetenschappelijk beschreven door Riemann-Zürneck in 1986.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max889 m

Depth min759 m

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Actinauge cristata has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes1

eDNA detections596

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.73%

Haplotypes0

BINs2

Where individuals differ — all 17 variable positions, in barcode order

88Tmostly conserved

181Cmostly conserved

202Amostly conserved

247Cmostly conserved

265Gmostly conserved

268Tmostly conserved

295Cmostly conserved

298Tmostly conserved

322Amostly conserved

355Tmostly conserved

373Amostly conserved

385Cmostly conserved

407Tmostly conserved

565Gmostly conserved

574Tmostly conserved

616Tmostly conserved

646Cmostly conserved

AACATTATATCTAGTCTTTGGAATGGGATCTGGTATGATAGGTACAGCTTTAAGTATGTTAATAAGATTGGAGCTATCTGCCCCTGGTAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Calliactis polypussame family3.1%Calliactis palliatasame family3.4%Stephanauge nexilissame order4.0%Cylista eleganssame order5.6%Cereus pedunculatussame order5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 680 records

Wild obs. + sensor1 562

Museum / vouchered118

Origin

Native1

Range

Area of Occupancy AOO3 060 km²

Depth

0–200 m sunlit226

200–1000 m twilight571

1–4 km midnight0

>4 km abyssal0

median 254.8 m · max 851.1 m · 797 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1 471≤1 km 16≤10 km 2

1 489 georeferenced · 73 without coordinates

Open the mapobservation + sensor1 562

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 118 records without

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	33
Maurice Lamontagne Institutelocation not on record	7
Centre for Biodiversity Genomicslocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Texas Cooperative Wildlife Collectionlocation not on record	1
WoRMS Editorial Boardlocation not on record	1

6 institutions · 47 of 118 vouchered records shown · 14 without an institution code

09Environmental DNA596 detections

Where the DNA of Actinauge cristata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found596

Studies independent surveys3

Countries1

Verifiable raw sequence linked596

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 596 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.40 °C -11.2–11.4

Seasonal swing summer↔winter35.5 °C

Max temp (day)9.50 °C -8.80–15.6

Min temp (night)3.40 °C -13.3–8.80

Precipitation89.4 mm/mo 31.1–116

Air humidity63.4 % 60.6–69.7

Moisture balance47.8 mm/mo

Vapour deficit330 Pa 78.7–531

Wind speed4.70 m/s

Cloud cover51.0 % 43.7–61.3

CHELSA 1981–2010, ~9 km grid, at location & month of 596 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Actinauge cristata

At a glance

Sources7 archives

Habitat & environment2

Other traits2

At a glance

Record type1 680 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 680 records