Anthocoris tomentosus

Péricart, 1971 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Anthocoridae/Anthocoris

At a glance

Occurrence records195

Data sources6

Biological traits0

DNA specimens29

eDNA detections23

Sources6 archives

Databases and archives Anthocoris tomentosus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility195 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF195 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD29 specimens

01Narrative

Anthocoris tomentosus is a species of minute pirate bug in the family Anthocoridae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocoris tomentosus has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P649 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 69 variable positions, in barcode order

15Cmostly conserved

18Gmostly conserved

30Amostly conserved

34Tmostly conserved

39Tmostly conserved

42Tmostly conserved

54Amostly conserved

57Tmostly conserved

78Gmostly conserved

81Tmostly conserved

84Amostly conserved

102Cmostly conserved

105Amostly conserved

120Tmostly conserved

123Tmostly conserved

153Cmostly conserved

168Cmostly conserved

216Amostly conserved

220Gmostly conserved

231Cmostly conserved

234Gmostly conserved

246Cmostly conserved

258Gmostly conserved

267Amostly conserved

270Tmostly conserved

276Tmostly conserved

315Cmostly conserved

321Tmostly conserved

324Cmostly conserved

348Tmostly conserved

354Tmostly conserved

369Amostly conserved

381Cmostly conserved

382Cmostly conserved

384Gmostly conserved

390Tmostly conserved

393Tmostly conserved

397Tmostly conserved

408Tmostly conserved

411Amostly conserved

414Gmostly conserved

423Tmostly conserved

424Tmostly conserved

438Tmostly conserved

441Tmostly conserved

454Tmostly conserved

474Amostly conserved

477Amostly conserved

491Tmostly conserved

492Tmostly conserved

495Amostly conserved

498Amostly conserved

510Amostly conserved

516Gmostly conserved

519Tmostly conserved

526Tmostly conserved

535Cmostly conserved

537Gmostly conserved

549Cmostly conserved

567Tmostly conserved

585Cmostly conserved

588Amostly conserved

597Cmostly conserved

612Tmostly conserved

624Amostly conserved

639Gmostly conserved

640Tmostly conserved

645Amostly conserved

646Cmostly conserved

TTATATTTTATATTCGGGATATGAGCAGGAATATTAGGTACTTCACTTAGATGAATTATTCGAATTGAACTAGGACAGCCTGGATCATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes5

BINs2

Most divergent pair9.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acompocoris pygmaeussame family11.7%Anthocoris gallarumulmisame genus11.7%Acompocoris alpinussame family11.9%Anthocoris antevolenssame genus12.3%Anthocoris confusussame genus12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type195 records

Wild obs. + sensor1

Museum / vouchered194

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 21≤1 km 1≤10 km 15

37 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence194

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	130
Edmonton, CA	25
Champaign, US	10
Universidad Católica de Manizaleslocation not on record	9
Royal Saskatchewan Museumlocation not on record	6
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
DOI/FWS, Kenai National Wildlife Refugelocation not on record	2
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1

8 institutions · 187 of 194 vouchered records shown · 7 without an institution code

09Environmental DNA23 detections

Where the DNA of Anthocoris tomentosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.1. TundraForest5. Wetlands (inland)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.80 °C 7.00–14.7

Seasonal swing summer↔winter36.8 °C

Max temp (day)11.5 °C 10.8–21.5

Min temp (night)5.00 °C 3.40–8.60

Precipitation77.3 mm/mo 42.3–106

Air humidity61.3 % 50.4–62.2

Moisture balance-13.6 mm/mo -97.7–12.4

Vapour deficit406 Pa 374–847

Wind speed3.10 m/s 2.00–4.20

Cloud cover60.3 % 34.9–61.0

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)