Anthocharis scolymus

Butler, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Anthocharis

At a glance

Occurrence records2 335

Data sources8

Biological traits0

DNA specimens14

eDNA detections12

Sources8 archives

Databases and archives Anthocharis scolymus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 335 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 335 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT2n = 62

01Narrative

Anthocharis scolymus, the yellow tip, is a butterfly in the subfamily Pierinae whose range is Eastern Asia (East China, Korea, Ussuri) where it is commonplace; occasionally it is found in Japan. The apex of the forewing is produced and falcate (sickle shaped); white above and below, with dark apical marking and black median spot on the forewing above, and a black spot at apex of hindwing; the male moreover, has a moderately large orange spot in the apical area of the forewing, occurring occasionally also in the female (= ab. virgo form. nov. The butterfly appears in one brood and is common in swampy places. The larva feeds on cress Julius Röber Pieridae, pp. 39-74, 374, pls. 17-27. In: Seitz, A. (ed.),1909 Die Groß-Schmetterlinge der Erde. 1. Band. Die palaearctischen Tagfalter. – Stuttgart, Fritz Lehmann. (Draba, Descurainia sophia, Arabis hirsuta, Cardamine impatiens and Rorippa).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocharis scolymus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs4

Marker genes1

eDNA detections12

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

13Cmostly conserved

31Cvariable

39Tmostly conserved

40Gvariable

43Amostly conserved

49Cvariable

76Amostly conserved

91Amostly conserved

100Amostly conserved

109Amostly conserved

111Tmostly conserved

136Cvariable

178Cmostly conserved

181Tmostly conserved

184Amostly conserved

197Cmostly conserved

199Tmostly conserved

200Amostly conserved

202Cmostly conserved

206Cmostly conserved

217Avariable

220Amostly conserved

235Tvariable

238Tvariable

262Avariable

271Cvariable

277Cmostly conserved

278Cmostly conserved

295Tvariable

313Tmostly conserved

358Tmostly conserved

364Cvariable

385Tmostly conserved

397Cmostly conserved

412Cvariable

424Tmostly conserved

427Tvariable

430Tmostly conserved

451Amostly conserved

490Tvariable

499Tmostly conserved

505Tmostly conserved

562Cvariable

565Avariable

592Tmostly conserved

616Tvariable

622Amostly conserved

628Amostly conserved

634Tmostly conserved

646Cvariable

AACTTTATATTTCATTTTTGGAATTTGATCCGGAATAGTGGGAACTTCCTTAAGTTTACTTATTCGAACTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes6

BINs4

Most divergent pair4.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Zegris faustisame family7.8%Euchloe bazaesame family8.1%Euchloe transcaspicasame family8.1%Euchloe melanochlorossame family8.2%Anthocharis euphenoidessame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_057569 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Anthocharis scolymus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 62 n = 31

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 311×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 621×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type2 335 records

Wild obs. + sensor623

Museum / vouchered1 712

Range

Area of Occupancy AOO3 796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 177≤1 km 70≤10 km 40>10 km 48

335 georeferenced · 288 without coordinates

Open the mapobservation + sensor623

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 3≤1 km 253≤10 km 25>10 km 18

299 georeferenced · 1 413 without coordinates

Open the institutions mapphysical evidence1 712

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Iwate Prefectural Museumlocation not on record	429
Chiba, JP	179
Bando, JP	147
Nagatoro-machi, Chichibu-gun, JP	108
Tokushima, JP	90
Tomioka, JP	89
Toyama, JP	60
Obihiro Centennial City Museumlocation not on record	53
Toyota city nature sanctuarylocation not on record	46
KIRMlocation not on record	45
JP	41
RCMlocation not on record	41
Gifu prefectural Museumlocation not on record	39
NSMKlocation not on record	30
Yokosuka City Museumlocation not on record	29
KCMNlocation not on record	29
Sanda, JP	29
KOMlocation not on record	27
Sagamihara, JP	21
Yamaguchi-shi, JP	21
Kushiro City Museumlocation not on record	21
Kawasaki Shi Tama Ku, JP	20
Sam Noble Oklahoma Museum of Natural Historylocation not on record	15
Cambridge, US	15
Tartu, EE	12
IJIBlocation not on record	11
Oiso Municipal Museumlocation not on record	11
Natural History Museum of Utahlocation not on record	9
Zürich, CH	7
New Haven, US	7
Natural History Museum Rotterdamlocation not on record	6
HUNMlocation not on record	6
Itami Shi, JP	4
MJINlocation not on record	4
Philadelphia, US	4
Shiojiri City Museum of Natural Historylocation not on record	3
Saga Prefectural Space and Science Museumlocation not on record	2

37 institutions · 1 710 of 1 712 vouchered records shown · 2 without an institution code

09Environmental DNA12 detections

Where the DNA of Anthocharis scolymus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 5.90–16.0

Seasonal swing summer↔winter27.3 °C

Max temp (day)17.5 °C 8.70–20.6

Min temp (night)6.20 °C 1.10–9.70

Precipitation98.6 mm/mo 70.7–294

Air humidity55.9 % 53.8–62.3

Moisture balance-32.9 mm/mo -38.6–209

Vapour deficit685 Pa 390–824

Wind speed3.00 m/s 2.80–3.20

Cloud cover41.6 % 37.4–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthocharis scolymus

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 335 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 335 records