Anthocharis lanceolata

Lucas, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Anthocharis

At a glance

Occurrence records317

Data sources7

Biological traits0

DNA specimens24

eDNA detections22

Sources7 archives

Databases and archives Anthocharis lanceolata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility317 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF317 records

Environmental DNA1 datasets · 1 countries22 detections

DNA & barcodingBOLD24 specimens

01Narrative

Anthocharis lanceolata, the gray marble, is a butterfly in the family Pieridae. The species was first described by Hippolyte Lucas in 1852. Its range is the west coast of United States and Canada.Note: This source gives Boisduval as the authority, but Savela gives that as a subspecies of Anthocharis lanceolata.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthocharis lanceolata has left across the world's sequence archives.

At a glance

DNA specimens24

BINs2

Marker genes1

eDNA detections22

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

43Amostly conserved

49Tmostly conserved

58Gmostly conserved

82Cmostly conserved

91Cmostly conserved

133Tmostly conserved

202Cmostly conserved

235Cmostly conserved

304Cmostly conserved

319Tmostly conserved

322Tmostly conserved

337Gmostly conserved

364Tmostly conserved

380Gmostly conserved

427Tmostly conserved

529Cmostly conserved

550Cmostly conserved

580Amostly conserved

622Tmostly conserved

628Amostly conserved

646Cvariable

AACCTTATATTTTATTTTTGGAATTTGATCTGGTATAGTAGGAACATCTCTTAGTATGTTAATTCGAACTGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes7

BINs2

Most divergent pair3.2%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthocharis beliasame genus6.4%Anthocharis cethurasame genus7.1%Anthocharis cardaminessame genus7.1%Zegris faustisame family7.1%Euchloe lottasame family7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type317 records

Wild obs. + sensor150

Museum / vouchered167

Range

Area of Occupancy AOO924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 44≤1 km 27≤10 km 20>10 km 10

101 georeferenced · 49 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 4≤1 km 46≤10 km 75>10 km 25

150 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence167

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	70
New Haven, US	41
Cleveland Museum of Natural History, OH (CLEV)location not on record	11
Cambridge, US	9
San Diego, US	7
Natural History Museum of Utahlocation not on record	6
East Lansing, US	6
Georgia Museum of Natural Historylocation not on record	6
St. Paul, US	3
Philadelphia, US	2
Tartu, EE	2
US	2
Vernal, US	1
Chicago, US	1

14 institutions · 167 of 167 vouchered records shown

09Environmental DNA22 detections

Where the DNA of Anthocharis lanceolata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.90 °C 5.70–17.1

Seasonal swing summer↔winter20.2 °C

Max temp (day)17.2 °C 11.9–24.5

Min temp (night)3.20 °C -0.8–9.20

Precipitation23.5 mm/mo 16.4–67.7

Air humidity48.7 % 45.3–58.5

Moisture balance-130 mm/mo -149–-17.9

Vapour deficit663 Pa 450–1,066

Wind speed2.70 m/s 1.50–3.40

Cloud cover31.1 % 26.2–39.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)