Anthidium maculifrons

Smith, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Anthidium

At a glance

Occurrence records484

Data sources7

Biological traits0

DNA specimens4

eDNA detections3

Sources7 archives

Databases and archives Anthidium maculifrons's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility484 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF484 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Anthidium maculifrons is a species of bee in the family Megachilidae, the leaf-cutter, carder, or mason bees.Griswold, T., and J. S. Ascher., 2005, Checklist of Apoidea of North America (including Central America and the Caribbean)Catalogue of Life : 2009 Annual Checklist : Literature references

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthidium maculifrons has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Diversity (π)3.6%

Haplotypes2

BINs2

Most divergent pair5.2%

Where individuals differ — all 37 variable positions, in barcode order

16Avariable

19Tvariable

46Avariable

82Cvariable

88Cvariable

184Amostly conserved

197Cvariable

202Avariable

205Avariable

220Avariable

235Cvariable

238Tmostly conserved

250Cvariable

266Cvariable

271Avariable

290Cvariable

307Cvariable

310Cvariable

343Amostly conserved

397Cvariable

416Avariable

421Amostly conserved

458Avariable

460Tmostly conserved

508Avariable

539Tmostly conserved

578Cvariable

589Cvariable

601Cvariable

604Cvariable

616Cvariable

619Avariable

631Avariable

634Cvariable

637Amostly conserved

653Cvariable

658Cvariable

AATATTATATATAATATTTGCTATATGAGCAGGAATAATTGGATCATCTTTAAGAATAATTATTCGAATAGAATTAAGAACCCCCGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthidium porteraesame genus8.7%Anthidium lotisame genus9.7%Anthidium funereumsame genus10.2%Anthidium mapuchesame genus10.5%Anthidium formosumsame genus10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type484 records

Wild obs. + sensor73

Museum / vouchered411

Range

Area of Occupancy AOO828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 29≤1 km 19≤10 km 5>10 km 12

65 georeferenced · 8 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 40≤1 km 2≤10 km 49>10 km 2

93 georeferenced · 318 without coordinates

Open the institutions mapphysical evidence411

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	65
	54
North Carolina State University Insect Museumlocation not on record	44
Champaign, US	37
Universidad de las Américas, Pueblalocation not on record	37
University of Central Floridalocation not on record	30
Ciudad de México, MX	29
Montgomery, US	26
University of Alabamalocation not on record	24
Lake Placid, US	18
Cambridge, US	8
Tapachula, MX	8
US	7
Mississippi State, US	6
Chicago, US	3
ECOSUR-SClocation not on record	2
Lexington, US	2
Beltsville, US	2
WIlocation not on record	2
UFPRlocation not on record	2
Awka, NG	1
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	1
San Nicolás de los Garza, MX	1
ASUlocation not on record	1
Blacksburg, US	1

25 institutions · 411 of 411 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Anthidium maculifrons was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 19.4–24.6

Seasonal swing summer↔winter17.4 °C

Max temp (day)27.7 °C 24.5–30.6

Min temp (night)15.2 °C 13.6–18.2

Precipitation46.5 mm/mo 45.0–53.5

Air humidity49.9 % 47.6–58.4

Moisture balance-78.6 mm/mo -101–-73.6

Vapour deficit1,272 Pa 945–1,625

Wind speed2.40 m/s 2.30–2.60

Cloud cover14.4 % 13.8–22.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)