Anthicus nanus

LeConte, 1851 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Anthicidae/Anthicus

At a glance

Occurrence records110

Data sources7

Biological traits0

DNA specimens7

eDNA detections4

Sources7 archives

Databases and archives Anthicus nanus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility110 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF110 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD7 specimens

01Narrative

Anthicus nanus is a species of antlike flower beetle in the family Anthicidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthicus nanus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

235Cvariable

316Gvariable

619Avariable

634Tvariable

TACCTTATATCTAATTTTTGGAGCATGGGCAGGAATAGTAGGAACATCGTTGAGACTTTTAATTCGATCAGAATTGGGAAACCCTGGTAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthicus bellulussame genus10.2%Amblyderus granularissame family13.1%Anthicus sellatussame genus13.5%Anthicus lutulentussame genus14.1%Anthicus punctulatussame genus14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type110 records

Museum / vouchered110

Range

Area of Occupancy AOO128 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence110

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	98
University of Central Floridalocation not on record	9
Cambridge, US	1
National Biodiversity Institute, Costa Ricalocation not on record	1
University of Alabamalocation not on record	1

5 institutions · 110 of 110 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Anthicus nanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

Beach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 8.10–20.3

Seasonal swing summer↔winter16.5 °C

Max temp (day)20.0 °C 13.8–26.2

Min temp (night)9.10 °C 2.10–16.1

Precipitation28.9 mm/mo 7.00–50.7

Air humidity56.8 % 53.5–60.1

Moisture balance-99.0 mm/mo -146–-51.7

Vapour deficit746 Pa 520–972

Wind speed2.20 m/s 1.90–2.50

Cloud cover28.1 % 15.8–40.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)