Anthene lycaenoides

(Felder, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Anthene

At a glance

Occurrence records235

Data sources7

Biological traits0

DNA specimens9

eDNA detections7

Sources7 archives

Databases and archives Anthene lycaenoides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility235 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF235 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD9 specimens

01Narrative

Anthene lycaenoides, the pale ciliate blue, is a butterfly of the family Lycaenidae. It is found from Malaya to New Guinea. The wingspan is about 25 mm. The larvae feed on Bridelia tomentosa, Rhyssopterys timorensis, Flagellaria indica, Clerodendrum floribundum, Oxera splendida, Cupaniopsis anacardioides, Pongamia pinnata, Caesalpina crista, Senna alata, Cassia fistula, Senna gaudichaudii and Senna surattensis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthene lycaenoides has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

37Gmostly conserved

454Cmostly conserved

463Tmostly conserved

536Tmostly conserved

562Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATGCTAGGAACATCATTAAGTATTTTAATTCGTATAGAATTAGGAACCCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.25%

Haplotypes3

BIN1

Most divergent pair0.76%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Theorema eumeniasame family7.3%Anthene paraffinissame genus7.6%Penaincisalia magnificasame family7.6%Calycopis calussame family7.8%Anthene liguressame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type235 records

Wild obs. + sensor207

Museum / vouchered28

Range

Area of Occupancy AOO532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 71≤1 km 34≤10 km 5>10 km 29

139 georeferenced · 68 without coordinates

Open the mapobservation + sensor207

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 10>10 km 5

15 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	12
Natick, US	9
Australian National Insect Collectionlocation not on record	3
Cambridge, US	2
Natural History Museum Rotterdamlocation not on record	1

5 institutions · 27 of 28 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Anthene lycaenoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 24.4–27.5

Seasonal swing summer↔winter0.7 °C

Max temp (day)29.2 °C 27.8–32.6

Min temp (night)22.0 °C 21.0–23.6

Precipitation125 mm/mo 48.1–248

Air humidity65.4 % 57.0–67.6

Moisture balance-6.80 mm/mo -101–112

Vapour deficit1,137 Pa 1,060–1,467

Wind speed0.9 m/s 0.8–2.60

Cloud cover44.4 % 35.2–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)