Anthela repleta

(Walker, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Anthelidae/Anthela

At a glance

Occurrence records665

Data sources7

Biological traits0

DNA specimens39

eDNA detections29

Sources7 archives

Databases and archives Anthela repleta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility665 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF665 records

Environmental DNA1 datasets · 1 countries29 detections

DNA & barcodingBOLD39 specimens

01Narrative

Anthela repleta is a moth of the Anthelidae family. It is found in Australia.Australian Faunal Directory

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthela repleta has left across the world's sequence archives.

At a glance

DNA specimens39

BINs8

Marker genes1

eDNA detections29

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

1Amostly conserved

40Amostly conserved

49Cvariable

50Cvariable

55Cvariable

79Amostly conserved

82Cvariable

97Tmostly conserved

100Gvariable

127Avariable

145Cvariable

154Tmostly conserved

202Cvariable

220Cmostly conserved

235Cmostly conserved

238Cvariable

266Cmostly conserved

268Gvariable

277Tmostly conserved

283Cvariable

287Tvariable

304Cvariable

322Amostly conserved

346Avariable

355Cvariable

364Cvariable

367Cmostly conserved

391Tvariable

394Cmostly conserved

412Tmostly conserved

418Tmostly conserved

421Amostly conserved

523Cvariable

541Amostly conserved

565Cvariable

574Tmostly conserved

578Tmostly conserved

589Tmostly conserved

616Tvariable

625Amostly conserved

634Cvariable

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCCCTAAGCTTATTAATTCGAGCTGAATTAGGAAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes13

BINs8

Most divergent pair6.8%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthela acutasame genus3.2%Anthela directasame genus3.5%Anthela cneciassame genus4.4%Anthela rufifasciasame genus4.4%Anthela variasame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type665 records

Wild obs. + sensor493

Museum / vouchered172

Range

Area of Occupancy AOO1 072 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 194≤1 km 144≤10 km 47>10 km 9

394 georeferenced · 99 without coordinates

Open the mapobservation + sensor493

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 33≤1 km 1≤10 km 12

46 georeferenced · 126 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	106
Tasmanian Museum & Art Gallerylocation not on record	40
Australian National Fish Collectionlocation not on record	12
NSW Dept of Planning, Industry and Environmentlocation not on record	2
DPIlocation not on record	2
Sydney, AU	2
ZSMlocation not on record	1
Natick, US	1

8 institutions · 166 of 172 vouchered records shown · 6 without an institution code

09Environmental DNA29 detections

Where the DNA of Anthela repleta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map1 country0

1. Forest & WoodlandDry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 7.70–20.7

Seasonal swing summer↔winter8.50 °C

Max temp (day)18.2 °C 10.7–24.8

Min temp (night)10.1 °C 4.30–16.5

Precipitation55.7 mm/mo 43.8–142

Air humidity59.7 % 56.4–62.6

Moisture balance-15.1 mm/mo

Vapour deficit698 Pa 399–929

Wind speed3.70 m/s

Cloud cover36.8 % 23.1–56.6

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)