Anthela acuta

(Walker, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Anthelidae/Anthela

At a glance

Occurrence records1 843

Data sources7

Biological traits0

DNA specimens16

eDNA detections8

Sources7 archives

Databases and archives Anthela acuta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 843 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 843 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD16 specimens

01Narrative

Anthela acuta, the common anthelid moth, is a moth of the family Anthelidae first described by Francis Walker in 1855. It is found in Australia.Australian Faunal Directory

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthela acuta has left across the world's sequence archives.

At a glance

DNA specimens16

BINs6

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

1Avariable

16Tmostly conserved

28Amostly conserved

59Tmostly conserved

61Amostly conserved

73Amostly conserved

82Cvariable

97Cvariable

100Avariable

154Tmostly conserved

160Amostly conserved

163Tmostly conserved

171Tmostly conserved

184Amostly conserved

202Cmostly conserved

212Cvariable

220Cvariable

235Cmostly conserved

238Tmostly conserved

244Amostly conserved

268Tvariable

271Cvariable

274Tmostly conserved

295Tmostly conserved

304Tmostly conserved

351Cmostly conserved

364Amostly conserved

367Tmostly conserved

379Tmostly conserved

400Amostly conserved

412Tmostly conserved

481Amostly conserved

514Tmostly conserved

517Amostly conserved

586Tmostly conserved

595Tmostly conserved

616Cmostly conserved

622Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAACCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes9

BINs6

Most divergent pair2.4%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthela directasame genus1.8%Anthela rufifasciasame genus2.1%Anthela posticasame genus2.7%Anthela variasame genus3.0%Anthela callixanthasame genus3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 843 records

Wild obs. + sensor1 461

Museum / vouchered382

Range

Area of Occupancy AOO2 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 519≤1 km 439≤10 km 108>10 km 58

1 124 georeferenced · 337 without coordinates

Open the mapobservation + sensor1 461

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 32≤1 km 7≤10 km 43>10 km 2

84 georeferenced · 298 without coordinates

Open the institutions mapphysical evidence382

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	290
Tasmanian Museum & Art Gallerylocation not on record	59
Australian National Fish Collectionlocation not on record	7
New Haven, US	5
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Sydney, AU	3
Natick, US	2
QVMAGlocation not on record	2

8 institutions · 371 of 382 vouchered records shown · 11 without an institution code

09Environmental DNA8 detections

Where the DNA of Anthela acuta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 13.6–18.4

Seasonal swing summer↔winter12.5 °C

Max temp (day)22.0 °C 18.4–23.8

Min temp (night)10.8 °C 8.60–13.5

Precipitation82.1 mm/mo 56.9–97.8

Air humidity57.0 % 54.2–60.3

Moisture balance-74.6 mm/mo -89.2–-31.7

Vapour deficit768 Pa 675–967

Wind speed2.30 m/s 1.40–3.70

Cloud cover22.2 % 20.7–29.7

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthela acuta

At a glance

Sources7 archives

At a glance

Record type1 843 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 843 records