Anthela postica

(Walker, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Anthelidae/Anthela

At a glance

Occurrence records8

Data sources7

Biological traits0

DNA specimens4

eDNA detections4

Sources7 archives

Databases and archives Anthela postica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Anthela postica is a moth of the Anthelidae family. It is found in Australia.Australian Faunal Directory

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthela postica has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes2

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes1

BINs2

Where individuals differ — all 15 variable positions, in barcode order

10Cvariable

79Gvariable

85Cvariable

197Cvariable

220Cvariable

259Tvariable

265Avariable

362Gvariable

364Avariable

388Avariable

418Cvariable

578Cvariable

595Cvariable

604Cvariable

616Cvariable

AACATTATACTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGGAATCCCGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthela acutasame genus2.7%Anthela rufifasciasame genus3.3%Anthela directasame genus3.5%Anthela variasame genus4.6%Anthela canescenssame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type8 records

Wild obs. + sensor1

Museum / vouchered7

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	2
Australian National Insect Collectionlocation not on record	1
Sydney, AU	1

3 institutions · 4 of 7 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Anthela postica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 10.1–16.7

Seasonal swing summer↔winter11.8 °C

Max temp (day)17.2 °C 14.3–21.9

Min temp (night)7.10 °C 6.20–12.0

Precipitation70.2 mm/mo 52.9–89.6

Air humidity57.4 % 55.9–62.6

Moisture balance-35.5 mm/mo -57.6–16.0

Vapour deficit617 Pa 480–809

Wind speed2.90 m/s 2.70–3.20

Cloud cover19.5 % 15.1–24.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)