Anthela oressarcha

Turner, 1921 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Anthelidae/Anthela

At a glance

Occurrence records28

Data sources7

Biological traits0

DNA specimens10

eDNA detections2

Sources7 archives

Databases and archives Anthela oressarcha's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD10 specimens

01Narrative

Anthela oressarcha is a moth of the Anthelidae family. It is found in Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthela oressarcha has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

34Cmostly conserved

38Gmostly conserved

81Amostly conserved

82Cmostly conserved

88Amostly conserved

163Amostly conserved

200Gmostly conserved

202Cmostly conserved

205Tmostly conserved

220Cmostly conserved

223Amostly conserved

235Cmostly conserved

274Tmostly conserved

283Tmostly conserved

301Cmostly conserved

335Gmostly conserved

391Cmostly conserved

394Cmostly conserved

400Cmostly conserved

412Amostly conserved

421Tmostly conserved

490Cmostly conserved

506Gmostly conserved

568Amostly conserved

601Tmostly conserved

607Tmostly conserved

619Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAAGAGGCTTAGTTGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.99%

Haplotypes3

BINs2

Most divergent pair0.61%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthela ochropterasame genus2.7%Anthela cneciassame genus2.9%Anthela ocellatasame genus2.9%Anthela habroptilasame genus3.5%Anthela pudicasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type28 records

Wild obs. + sensor11

Museum / vouchered17

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 4≤1 km 2≤10 km 2

8 georeferenced · 3 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museums Victorialocation not on record	3
Australian National Fish Collectionlocation not on record	3
Tasmanian Museum & Art Gallerylocation not on record	2
Australian National Insect Collectionlocation not on record	1

4 institutions · 9 of 17 vouchered records shown · 8 without an institution code

09Environmental DNA2 detections

Where the DNA of Anthela oressarcha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 14.6–15.7

Seasonal swing summer↔winter14.9 °C

Max temp (day)20.8 °C 20.5–21.1

Min temp (night)9.40 °C 8.90–9.90

Precipitation94.8 mm/mo 92.8–96.7

Air humidity55.4 % 54.1–56.6

Moisture balance-47.3 mm/mo -63.4–-31.1

Vapour deficit774 Pa 725–824

Wind speed2.50 m/s 1.90–3.10

Cloud cover21.6 % 21.5–21.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)