Anthela ocellata

(Walker, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Anthelidae/Anthela

At a glance

Occurrence records882

Data sources7

Biological traits0

DNA specimens49

eDNA detections49

Sources7 archives

Databases and archives Anthela ocellata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility882 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF882 records

Environmental DNA1 datasets · 1 countries49 detections

DNA & barcodingBOLD49 specimens

01Narrative

Anthela ocellata, the eyespot anthelid, is a moth of the family Anthelidae. The species was first described by Francis Walker in 1855. It is found in Australia, from Bundaberg to Hobart along the east coast. The wingspan is about 60 mm. The larvae feed on various grasses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthela ocellata has left across the world's sequence archives.

At a glance

DNA specimens49

BINs1

Marker genes1

eDNA detections49

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

10Tvariable

40Tvariable

50Tvariable

82Cmostly conserved

133Tvariable

235Cmostly conserved

250Tmostly conserved

262Amostly conserved

281Amostly conserved

433Amostly conserved

478Tmostly conserved

535Avariable

601Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAAGAGGATTAGTTGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAACCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.68%

Haplotypes14

BIN1

Most divergent pair1.8%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthela oressarchasame genus2.9%Anthela ochropterasame genus3.0%Anthela habroptilasame genus3.6%Anthela cneciassame genus5.0%Anthela tetraphricasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type882 records

Wild obs. + sensor699

Museum / vouchered183

Range

Area of Occupancy AOO1 588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 311≤1 km 147≤10 km 31>10 km 42

531 georeferenced · 168 without coordinates

Open the mapobservation + sensor699

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 21≤10 km 13

34 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence183

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	137
Australian National Fish Collectionlocation not on record	15
Tasmanian Museum & Art Gallerylocation not on record	15
DPIlocation not on record	2
New Haven, US	1
Australian National Insect Collectionlocation not on record	1
QVMAGlocation not on record	1

7 institutions · 172 of 183 vouchered records shown · 11 without an institution code

09Environmental DNA49 detections

Where the DNA of Anthela ocellata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 12.8–20.7

Seasonal swing summer↔winter11.3 °C

Max temp (day)23.0 °C 18.5–25.5

Min temp (night)13.0 °C 7.00–16.5

Precipitation70.0 mm/mo 44.3–142

Air humidity57.2 % 56.4–62.6

Moisture balance-49.7 mm/mo -69.5–20.8

Vapour deficit872 Pa 634–965

Wind speed2.50 m/s 2.40–3.00

Cloud cover21.2 % 18.0–30.3

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)