Anthela ferruginosa

Walker, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Anthelidae/Anthela

At a glance

Occurrence records533

Data sources7

Biological traits0

DNA specimens13

eDNA detections13

Sources7 archives

Databases and archives Anthela ferruginosa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility533 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF533 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Anthela ferruginosa is a species of moth of the family Anthelidae. It is found in Australia. The wingspan is about 40 mm. The larvae feed on various Australian Poaceae species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthela ferruginosa has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 53 variable positions, in barcode order

13Cmostly conserved

22Amostly conserved

23Amostly conserved

31Amostly conserved

40Tmostly conserved

43Tvariable

50Tmostly conserved

85Amostly conserved

106Tmostly conserved

118Tmostly conserved

130Amostly conserved

172Tmostly conserved

217Amostly conserved

220Tmostly conserved

235Tvariable

238Tmostly conserved

266Tvariable

271Cmostly conserved

283Tmostly conserved

286Amostly conserved

307Amostly conserved

313Tmostly conserved

334Avariable

347Tmostly conserved

352Avariable

361Tmostly conserved

364Cvariable

367Tmostly conserved

379Tmostly conserved

385Cmostly conserved

394Tmostly conserved

397Cmostly conserved

407Tmostly conserved

421Tmostly conserved

433Amostly conserved

436Cvariable

439Tmostly conserved

442Tmostly conserved

445Tmostly conserved

478Cvariable

490Tmostly conserved

505Tmostly conserved

517Tmostly conserved

529Tmostly conserved

536Tmostly conserved

541Amostly conserved

574Tmostly conserved

586Tvariable

589Cvariable

596Cvariable

607Tmostly conserved

616Tvariable

628Amostly conserved

AACTTTATATTTCATTTTTGGAATTTGAGCAGGAATAGTTGGTACATCTTTAAGTTTAATAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes8

BINs2

Most divergent pair4.9%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthela directasame genus5.8%Anthela acutasame genus5.9%Anthela rubeolasame genus6.1%Anthela rufifasciasame genus6.2%Anthela barnardisame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type533 records

Wild obs. + sensor406

Museum / vouchered127

Range

Area of Occupancy AOO648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 132≤1 km 108≤10 km 8>10 km 13

261 georeferenced · 145 without coordinates

Open the mapobservation + sensor406

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 11≤10 km 3

14 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence127

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Museums Victorialocation not on record	102
Tasmanian Museum & Art Gallerylocation not on record	12
Australian National Fish Collectionlocation not on record	4
NSW Dept of Planning, Industry and Environmentlocation not on record	2
QVMAGlocation not on record	2

5 institutions · 122 of 127 vouchered records shown · 5 without an institution code

09Environmental DNA13 detections

Where the DNA of Anthela ferruginosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 15.5–20.7

Seasonal swing summer↔winter13.8 °C

Max temp (day)23.0 °C 19.6–25.5

Min temp (night)11.7 °C 10.7–16.5

Precipitation48.1 mm/mo 18.6–142

Air humidity56.8 % 53.0–62.6

Moisture balance-58.5 mm/mo -77.4–-16.5

Vapour deficit850 Pa 791–996

Wind speed2.20 m/s 2.10–3.50

Cloud cover17.2 % 15.8–29.3

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)