Anthaxia viridicornis

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records37

Data sources8

Biological traits0

DNA specimens16

eDNA detections10

Sources8 archives

Databases and archives Anthaxia viridicornis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD16 specimens

01Narrative

Anthaxia viridicornis is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia viridicornis has left across the world's sequence archives.

At a glance

DNA specimens16

BINs3

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

49Gmostly conserved

79Tvariable

124Tmostly conserved

136Cmostly conserved

157Cvariable

166Gvariable

169Amostly conserved

202Avariable

205Tmostly conserved

212Tmostly conserved

271Cvariable

277Tvariable

373Gmostly conserved

379Cmostly conserved

400Tvariable

415Avariable

421Amostly conserved

463Cvariable

466Amostly conserved

553Tvariable

586Cmostly conserved

631Amostly conserved

634Cvariable

AACACTTTACTTTATATTTGGTGCATGATCTGGTATAATAGGAACAGCGCTAAGATTATTAATCCGAGCAGAATTAGGTAATCCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes6

BINs3

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia caseyisame genus11.4%Anthaxia fisherisame genus11.9%Anthaxia umbellatarumsame genus15.5%Temognatha herossame family16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor16

Museum / vouchered21

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 9≤1 km 6≤10 km 1

16 georeferenced

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 2

4 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Central Floridalocation not on record	9
Lexington, US	3
WIlocation not on record	2
Lubbock, US	2
CUlocation not on record	1
Wuzhou, CN	1
Natural History Museum of Utahlocation not on record	1
College Station, US	1

8 institutions · 20 of 21 vouchered records shown · 1 without an institution code

09Environmental DNA10 detections

Where the DNA of Anthaxia viridicornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 13.6–20.1

Seasonal swing summer↔winter31.2 °C

Max temp (day)23.8 °C 17.7–24.4

Min temp (night)13.9 °C 8.40–16.4

Precipitation109 mm/mo 88.3–138

Air humidity58.2 % 57.9–59.0

Moisture balance-40.0 mm/mo -64.6–18.1

Vapour deficit918 Pa 670–978

Wind speed3.80 m/s 3.00–3.90

Cloud cover44.8 % 42.2–52.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)