Anthaxia caseyi

Obenberger, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records26

Data sources8

Biological traits0

DNA specimens15

eDNA detections17

Sources8 archives

Databases and archives Anthaxia caseyi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF26 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD15 specimens

01Narrative

Anthaxia caseyi is a species of metallic wood-boring beetle in the family Buprestidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia caseyi has left across the world's sequence archives.

At a glance

DNA specimens15

BINs2

Marker genes1

eDNA detections17

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 74 variable positions, in barcode order

5Cmostly conserved

7Tmostly conserved

10Cmostly conserved

13Tmostly conserved

25Amostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

34Tmostly conserved

38Amostly conserved

46Amostly conserved

50Tmostly conserved

56Tmostly conserved

58Amostly conserved

59Tmostly conserved

61Gmostly conserved

67Amostly conserved

74Tmostly conserved

82Cmostly conserved

85Amostly conserved

91Cmostly conserved

92Cmostly conserved

112Tmostly conserved

127Tmostly conserved

133Amostly conserved

136Tmostly conserved

139Amostly conserved

143Amostly conserved

151Tmostly conserved

154Tmostly conserved

157Tmostly conserved

160Gmostly conserved

181Amostly conserved

202Amostly conserved

235Cvariable

262Gmostly conserved

307Cmostly conserved

358Tmostly conserved

379Cmostly conserved

385Tmostly conserved

400Tvariable

403Cmostly conserved

406Tmostly conserved

427Cmostly conserved

445Tmostly conserved

458Amostly conserved

466Amostly conserved

472Tmostly conserved

475Amostly conserved

492Amostly conserved

499Cmostly conserved

511Gvariable

514Amostly conserved

518Tmostly conserved

523Tmostly conserved

535Tmostly conserved

541Cmostly conserved

547Amostly conserved

550Cmostly conserved

553Gmostly conserved

556Cmostly conserved

574Tmostly conserved

577Avariable

578Cmostly conserved

580Tmostly conserved

581Tmostly conserved

607Tmostly conserved

610Tmostly conserved

619Tmostly conserved

631Amostly conserved

643Tmostly conserved

646Tmostly conserved

649Gmostly conserved

AACACTTTACTTTATTTTTGGTGCATGATCTGGTATAATAGGAACAGCATTAAGATTATTGATTCGAGCAGAATTAGGAAACCCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes7

BINs2

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia viridicornissame genus11.4%Anthaxia fisherisame genus12.5%Merimna atratasame family14.6%Rhizophagus fenestralissame order15.0%Anthaxia aeneogastersame genus15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor9

Museum / vouchered17

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 1≤10 km 3

6 georeferenced · 3 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	5
The College of Idaho, Orma J. Smith Museum of Natural Historylocation not on record	5
Vernal, US	3
University of Central Floridalocation not on record	3
US	1

5 institutions · 17 of 17 vouchered records shown

09Environmental DNA17 detections

Where the DNA of Anthaxia caseyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 12.2–28.0

Seasonal swing summer↔winter21.7 °C

Max temp (day)23.0 °C 17.9–35.7

Min temp (night)8.80 °C 6.00–21.1

Precipitation17.7 mm/mo 10.1–81.0

Air humidity48.2 % 46.1–54.8

Moisture balance-143 mm/mo -205–-35.6

Vapour deficit964 Pa 660–1,999

Wind speed2.60 m/s 1.80–5.60

Cloud cover30.1 % 12.9–41.3

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)