Anthaxia sepulchralis

(Fabricius, 1801) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records1 380

Data sources7

Biological traits0

DNA specimens8

eDNA detections6

Sources7 archives

Databases and archives Anthaxia sepulchralis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 380 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 380 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD8 specimens

01Narrative

Anthaxia sepulchralis é uma espécie de insetos coleópteros polífagos pertencente à família Buprestidae. A autoridade científica da espécie é Fabricius, tendo sido descrita no ano de 1801. Trata-se de uma espécie presente no território português.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia sepulchralis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections6

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 97 variable positions, in barcode order

10Cmostly conserved

13Cmostly conserved

19Cvariable

22Tmostly conserved

31Amostly conserved

34Tvariable

46Cmostly conserved

49Tmostly conserved

52Amostly conserved

61Tmostly conserved

74Cmostly conserved

79Tmostly conserved

82Tmostly conserved

85Cvariable

89Gmostly conserved

91Amostly conserved

92Cmostly conserved

109Amostly conserved

118Tmostly conserved

136Tmostly conserved

145Cmostly conserved

157Tmostly conserved

163Amostly conserved

181Tmostly conserved

193Cmostly conserved

202Gmostly conserved

205Cmostly conserved

211Amostly conserved

212Cmostly conserved

214Tmostly conserved

217Amostly conserved

220Amostly conserved

223Tmostly conserved

238Tmostly conserved

250Tmostly conserved

259Cmostly conserved

262Gmostly conserved

265Cmostly conserved

271Cmostly conserved

277Tmostly conserved

280Tmostly conserved

292Cmostly conserved

293Tmostly conserved

307Tmostly conserved

316Amostly conserved

319Amostly conserved

322Tmostly conserved

340Tmostly conserved

343Amostly conserved

352Tmostly conserved

355Amostly conserved

358Cmostly conserved

364Tmostly conserved

367Cmostly conserved

373Amostly conserved

376Cmostly conserved

379Tmostly conserved

385Cmostly conserved

386Cmostly conserved

400Cvariable

403Gmostly conserved

415Amostly conserved

418Tmostly conserved

421Amostly conserved

430Tmostly conserved

457Amostly conserved

463Tmostly conserved

478Tmostly conserved

482Tmostly conserved

493Amostly conserved

499Cmostly conserved

500Cmostly conserved

514Tmostly conserved

517Amostly conserved

523Tmostly conserved

533Tmostly conserved

535Amostly conserved

536Tmostly conserved

538Amostly conserved

541Tmostly conserved

547Amostly conserved

553Tmostly conserved

556Tmostly conserved

559Tmostly conserved

562Amostly conserved

565Amostly conserved

568Amostly conserved

581Cmostly conserved

586Amostly conserved

595Tmostly conserved

610Cmostly conserved

622Cmostly conserved

634Cmostly conserved

637Amostly conserved

643Cmostly conserved

653Cmostly conserved

658Cmostly conserved

AACATTATACTTCATTTTCGGTGCCTGATCAGGTATAGTAGGAACCGCTCTAAGACTTCTTATTCGTGCAGAACTAGGTAATCCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.0%

Haplotypes5

BINs2

Most divergent pair14.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia aeneogastersame genus10.8%Anthaxia inornatasame genus12.2%Anthaxia istrianasame genus12.5%Anthaxia helveticasame genus13.4%Anthaxia corsicasame genus14.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 380 records

Wild obs. + sensor918

Museum / vouchered333

Other129

Origin

Native225

Range

Area of Occupancy AOO2 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 120≤1 km 139≤10 km 442>10 km 18

719 georeferenced · 199 without coordinates

Open the mapobservation + sensor918

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤1 km 38≤10 km 267>10 km 5

310 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence333

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bern, CH	47
Provincia di Livornolocation not on record	26
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	14
Natural History Museum Rotterdamlocation not on record	12
Musee d'Histoire Naturallelocation not on record	11
Sion, CH	9
Fribourg, CH	6
Geneva, CH	6
Paro, BT	6
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Helsinki, FI	4
Zürich, CH	3
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	2
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	2
Naturmuseum Oltenlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	1
Universita di Firenze, Museo di Storia Naturalelocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

18 institutions · 157 of 333 vouchered records shown · 176 without an institution code

09Environmental DNA6 detections

Where the DNA of Anthaxia sepulchralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 11.5–17.7

Seasonal swing summer↔winter16.0 °C

Max temp (day)19.2 °C 15.3–20.2

Min temp (night)12.5 °C 6.20–14.6

Precipitation60.6 mm/mo 48.5–78.6

Air humidity59.6 % 57.4–61.1

Moisture balance-39.9 mm/mo

Vapour deficit775 Pa 580–800

Wind speed2.20 m/s

Cloud cover39.6 % 38.0–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthaxia sepulchralis

At a glance

Sources7 archives

At a glance

Record type1 380 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 380 records