Anthaxia morio

(Fabricius, 1793) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Anthaxia

At a glance

Occurrence records2 730

Data sources7

Biological traits0

DNA specimens13

eDNA detections15

Sources7 archives

Databases and archives Anthaxia morio's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 730 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 730 records

Environmental DNA2 datasets · 3 countries15 detections

DNA & barcodingBOLD13 specimens

01Narrative

Anthaxia morio adalah spesies kumbang yang tergolong ke dalam famili Buprestidae. Spesies ini juga merupakan bagian dari ordo Coleoptera. Spesies Anthaxia morio sendiri merupakan bagian dari genus Anthaxia. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Fabricius, 1793.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anthaxia morio has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections15

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

49Tmostly conserved

89Gmostly conserved

169Cmostly conserved

181Gmostly conserved

226Tmostly conserved

241Tmostly conserved

316Tmostly conserved

417Tmostly conserved

AACTTTATACTTCATTTTTGGAGCTTGATCCGGAATAGTAGGAACAGCTCTTAGTCTTCTAATTCGTGCTGAACTAGGAAACCCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes7

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthaxia inornatasame genus14.4%Anthaxia sepulchralissame genus14.9%Anthaxia aeneogastersame genus15.3%Anthaxia bicolorsame genus15.8%Anthaxia istrianasame genus16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 730 records

Wild obs. + sensor1 639

Museum / vouchered1 070

Other21

Origin

Native553

Range

Area of Occupancy AOO5 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 738≤1 km 346≤10 km 439>10 km 12

1 535 georeferenced · 104 without coordinates

Open the mapobservation + sensor1 639

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 90≤1 km 97≤10 km 806>10 km 12

1 005 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence1 070

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Musee d'Histoire Naturallelocation not on record	120
SLU Artdatabankenlocation not on record	93
Bern, CH	76
Geneva, CH	48
Zürich, CH	48
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	44
Trondheim, NO	40
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	32
Paro, BT	29
Muzeum Górnośląskie w Bytomiulocation not on record	29
Dhaka, BD	22
NTNU-VMlocation not on record	20
NMBU:MINAlocation not on record	19
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	16
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	15
Fribourg, CH	10
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	10
Frauenfeld, CH	10
Salzburg, AT	10
NHMOlocation not on record	10
Provincia di Livornolocation not on record	5
neflocation not on record	5
Natural History Museum Rotterdamlocation not on record	4
Museum zu Allerheiligen Schaffhausenlocation not on record	4
Sion, CH	3
BioFokuslocation not on record	3
Porrentruy, CH	2
Helsinki, FI	2
MZLUlocation not on record	2
IFR-DNFlocation not on record	1
ZSMlocation not on record	1
Norwegian University of Life Sciences (NMBU)location not on record	1
INCONNUlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

34 institutions · 736 of 1 070 vouchered records shown · 334 without an institution code

09Environmental DNA15 detections

Where the DNA of Anthaxia morio was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys2

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map3 countries0

Mischwald

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 11.9–17.2

Seasonal swing summer↔winter18.7 °C

Max temp (day)18.7 °C 15.9–21.4

Min temp (night)9.40 °C 6.70–12.7

Precipitation83.2 mm/mo 59.5–136

Air humidity59.8 % 57.6–61.7

Moisture balance-36.0 mm/mo -54.7–32.8

Vapour deficit687 Pa 587–811

Wind speed3.10 m/s 2.50–3.80

Cloud cover35.0 % 30.4–39.2

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anthaxia morio

At a glance

Sources7 archives

At a glance

Record type2 730 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 730 records