Anterhynchium rufipes

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Eumenidae/Anterhynchium

At a glance

Occurrence records76

Data sources5

Biological traits0

DNA specimens18

eDNA detections9

Sources5 archives

Databases and archives Anterhynchium rufipes's data was compiled from.

GBIFGlobal Biodiversity Information Facility76 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF76 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD18 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anterhynchium rufipes has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AATTTTATATTTCATTTTTGGATTATGATCAGGAATAATTGGATCATCTATAAGAATAATTATTCGATTAGAATTAGGTAATCCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancistrocerus longispinosussame family13.2%Euodynerus notatussame family13.2%Euodynerus crypticussame family13.7%Euodynerus quadrifasciatussame family13.8%Ancistrocerus ichneumonideussame family14.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type76 records

Wild obs. + sensor37

Museum / vouchered39

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 20≤1 km 10≤10 km 3

33 georeferenced · 4 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 11≤1 km 8≤10 km 2

21 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratoire Biométrie et Biologie Evolutive, University Lyon 1location not on record	18
Universite Claude Bernard Lyon 1location not on record	9
Auckland, NZ	3

3 institutions · 30 of 39 vouchered records shown · 9 without an institution code

09Environmental DNA9 detections

Where the DNA of Anterhynchium rufipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 25.2–26.7

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.2 °C 25.8–27.5

Min temp (night)25.5 °C 24.4–25.7

Precipitation284 mm/mo 165–310

Air humidity63.6 % 61.2–68.6

Vapour deficit1,247 Pa 983–1,299

Cloud cover37.9 % 16.4–40.3

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)