Anterastria teratophora

Herrich-Schäffer · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anterastria

At a glance

Occurrence records592

Data sources6

Biological traits0

DNA specimens9

eDNA detections9

Sources6 archives

Databases and archives Anterastria teratophora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility592 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF592 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Anterastria teratophora, the grey marvel, is a moth of the family Noctuidae. The species was first described by Gottlieb August Wilhelm Herrich-Schäffer in 1854. It is found in North America from Quebec west to central Alberta, south to Florida and Arizona. The wingspan is about 25 mm. Adults are on wing from May to August depending on the location. There is one generation per year. The larvae feed on Mentha and Monarda species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anterastria teratophora has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTTATTTTTGGAATCTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anterastria atratasame genus4.1%Bryophila tephrocharissame family5.5%Condica circuitasame family5.8%Lophoterges hoerhammerisame family5.8%Neumoegenia poeticasame family5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type592 records

Wild obs. + sensor406

Museum / vouchered186

Range

Area of Occupancy AOO1 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 224≤1 km 63≤10 km 14>10 km 40

341 georeferenced · 65 without coordinates

Open the mapobservation + sensor406

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 13≤1 km 32≤10 km 39>10 km 11

95 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence186

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	48
North Carolina State University Insect Museumlocation not on record	21
New Haven, US	20
St. Paul, US	16
University of Alberta Museums (UAM)location not on record	13
Colorado State Universitylocation not on record	13
Royal Saskatchewan Museumlocation not on record	12
Mississippi State, US	9
Denver, US	7
King Saud Universitylocation not on record	5
Decorah, US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
OSUClocation not on record	1

14 institutions · 174 of 186 vouchered records shown · 12 without an institution code

09Environmental DNA9 detections

Where the DNA of Anterastria teratophora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 13.7–23.3

Seasonal swing summer↔winter25.8 °C

Max temp (day)23.2 °C 19.0–28.4

Min temp (night)14.4 °C 9.00–18.1

Precipitation96.5 mm/mo 80.6–154

Air humidity57.5 % 56.3–64.9

Moisture balance-48.6 mm/mo -70.1–29.7

Vapour deficit848 Pa 648–1,194

Wind speed3.00 m/s 2.80–3.60

Cloud cover38.0 % 27.5–45.0

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)