Neumoegenia poetica

Grote, 1882 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Neumoegenia

At a glance

Occurrence records759

Data sources7

Biological traits0

DNA specimens9

eDNA detections9

Sources7 archives

Databases and archives Neumoegenia poetica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility759 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF759 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Neumoegenia poetica, the poetry moth, is a species of moth in the family Noctuidae (the owlet moths). It is found in North America. The MONA or Hodges number for Neumoegenia poetica is 9737.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neumoegenia poetica has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

109Avariable

368Gmostly conserved

379Avariable

403Amostly conserved

430Avariable

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes4

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chalcopasta territanssame family3.5%Plagiomimicus curiosumsame family3.5%Plagiomimicus spumosumsame family4.0%Plagiomimicus tepperisame family4.1%Xanthothrix ranunculisame family4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type759 records

Wild obs. + sensor514

Museum / vouchered245

Range

Area of Occupancy AOO696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 305≤1 km 70≤10 km 12>10 km 13

400 georeferenced · 114 without coordinates

Open the mapobservation + sensor514

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 18≤1 km 77≤10 km 84>10 km 5

184 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence245

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	102
Mississippi State, US	52
East Lansing, US	45
New Haven, US	13
Colorado State Universitylocation not on record	8
St. Paul, US	6
Washington, US	4
Cornell University Insect Collectionlocation not on record	4
Denver, US	4
University of Alberta Museums (UAM)location not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Awka, NG	1

12 institutions · 243 of 245 vouchered records shown · 2 without an institution code

09Environmental DNA9 detections

Where the DNA of Neumoegenia poetica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

Oak-manzanita and grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 16.7–26.1

Seasonal swing summer↔winter17.8 °C

Max temp (day)31.4 °C 23.7–31.9

Min temp (night)18.9 °C 10.2–20.6

Precipitation107 mm/mo 40.1–123

Air humidity50.1 % 46.1–54.4

Moisture balance-65.0 mm/mo -79.0–-34.2

Vapour deficit1,508 Pa 1,064–1,648

Wind speed2.00 m/s 1.90–2.30

Cloud cover17.3 % 16.8–18.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)