Antaea licormas

Cramer, 1779 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Notodontidae/Antaea

At a glance

Occurrence records158

Data sources5

Biological traits0

DNA specimens84

eDNA detections85

Sources5 archives

Databases and archives Antaea licormas's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility158 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI85 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics84 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF158 records

Environmental DNA1 datasets · 5 countries85 detections

DNA & barcodingBOLD84 specimens

01Narrative

Antaea licormas is een vlinder uit de familie van de tandvlinders (Notodontidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1779 door Cramer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding84 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antaea licormas has left across the world's sequence archives.

At a glance

DNA specimens84

BINs1

Marker genes1

eDNA detections85

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus83 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

67Gvariable

133Cvariable

265Cvariable

403Cvariable

451Cvariable

460Tvariable

596Cmostly conserved

613Tvariable

646Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGGGCTGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes7

BIN1

Most divergent pair1.7%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antaea lichyisame genus8.1%Tautobriga euspilasame order9.0%Cuneisigna cumamitasame order9.1%Hyposada hydrocampatasame order9.3%Argyroeides minutasame order9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type158 records

Wild obs. + sensor19

Museum / vouchered139

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 5≤1 km 7≤10 km 3>10 km 3

18 georeferenced · 1 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 2≤10 km 3

5 georeferenced · 134 without coordinates

Open the institutions mapphysical evidence139

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	110
The University of the West Indies, Trinidad and Tobagolocation not on record	11
East Lansing, US	3
Ciudad de México, MX	2
Tapachula, MX	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	1

7 institutions · 131 of 139 vouchered records shown · 8 without an institution code

09Environmental DNA85 detections

Where the DNA of Antaea licormas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found85

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 85 detections have coordinates

Open the map5 countries0

Tropical dry forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 20.6–25.7

Seasonal swing summer↔winter8.80 °C

Max temp (day)27.6 °C 26.1–29.8

Min temp (night)20.6 °C 16.7–23.9

Precipitation183 mm/mo 85.8–404

Air humidity61.6 % 58.2–69.6

Moisture balance22.4 mm/mo -25.5–276

Vapour deficit1,071 Pa 930–1,275

Wind speed2.90 m/s 1.70–3.80

Cloud cover37.2 % 23.9–56.0

CHELSA 1981–2010, ~9 km grid, at location & month of 85 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)