Antaea lichyi

Franclemont, 1942 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Notodontidae/Antaea

At a glance

Occurrence records255

Data sources5

Biological traits0

DNA specimens78

eDNA detections79

Sources5 archives

Databases and archives Antaea lichyi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility255 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics78 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF255 records

Environmental DNA1 datasets · 5 countries79 detections

DNA & barcodingBOLD78 specimens

01Narrative

Antaea lichyi is een vlinder uit de familie van de tandvlinders (Notodontidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1942 door Franclemont.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding78 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antaea lichyi has left across the world's sequence archives.

At a glance

DNA specimens78

BINs1

Marker genes1

eDNA detections79

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus74 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

67Gmostly conserved

100Amostly conserved

160Gmostly conserved

328Avariable

589Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTTGGAACTTCCCTAAGATTATTAATTCGGGCAGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes15

BIN1

Most divergent pair0.91%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antaea licormassame genus8.1%Chliara cresussame family9.1%Nystalea virgulasame family9.4%Sicya croceariasame order9.4%Thallogama panstictasame order9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type255 records

Wild obs. + sensor17

Museum / vouchered238

Range

Area of Occupancy AOO356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 10≤1 km 3≤10 km 2

15 georeferenced · 2 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 2

4 georeferenced · 234 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	205
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	4
East Lansing, US	4

3 institutions · 213 of 238 vouchered records shown · 25 without an institution code

09Environmental DNA79 detections

Where the DNA of Antaea lichyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found79

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 79 detections have coordinates

Open the map5 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…secondary vegetation white sand savanna

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 23.0–25.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.4 °C 26.1–29.3

Min temp (night)22.0 °C 20.3–23.7

Precipitation269 mm/mo 54.8–425

Air humidity69.1 % 64.7–73.3

Moisture balance126 mm/mo -103–317

Vapour deficit939 Pa 814–1,145

Wind speed2.00 m/s 0.8–4.90

Cloud cover32.0 % 15.2–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 79 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)