Anotylus insecatus

(Gravenhorst, 1806) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Staphylinidae/Anotylus

At a glance

Occurrence records692

Data sources6

Biological traits0

DNA specimens34

eDNA detections35

Sources6 archives

Databases and archives Anotylus insecatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility692 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF692 records

Environmental DNA2 datasets · 8 countries35 detections

DNA & barcodingBOLD34 specimens

01Narrative

Anotylus insecatus is a species of rove beetles native to Europe.Fauna EuropaeaNorman H. Joy, , 1932 A Practical Handbook of British Beetles

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anotylus insecatus has left across the world's sequence archives.

At a glance

DNA specimens34

BINs2

Marker genes3

eDNA detections35

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

43Avariable

58Gvariable

80Gvariable

121Avariable

163Gvariable

202Cvariable

217Avariable

310Gvariable

346Cvariable

352Avariable

361Tvariable

418Tvariable

433Avariable

502Avariable

550Avariable

586Avariable

613Tvariable

616Cvariable

634Cmostly conserved

TACTTTATACTTTATTTTTGGGGCTTGATCAGGAATAGTTGGAACATCCCTCAGAATGCTAATTCGAGCAGAATTAGGAGCCCCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes3

BINs2

Most divergent pair2.7%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anotylus rugosussame genus10.8%Orthaga amphimelassame order16.0%Archernis callixanthasame order16.0%Argyrogramma verrucasame order16.0%Pollanisus cyanotasame order16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type692 records

Wild obs. + sensor201

Museum / vouchered479

Cultivated / captive2

Fossil10

Range

Area of Occupancy AOO1 328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 65≤1 km 61≤10 km 37>10 km 3

166 georeferenced · 35 without coordinates

Open the mapobservation + sensor201

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 47≤1 km 97≤10 km 54>10 km 3

201 georeferenced · 278 without coordinates

Open the institutions mapphysical evidence479

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	81
Luhanskyi Nature Reserve, Stanychno-Luhanskyi Division,location not on record	74
State Museum of Nature History, Lvivlocation not on record	71
Cambridge, US	23
Ghent, BE	15
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Uniwersytet Wrocławskilocation not on record	7
Tilburg, NL	7
Olocation not on record	7
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	7
ZSMlocation not on record	6
Helsinki, FI	6
Kuopio, FI	4
NMOKlocation not on record	3
Tartu, EE	3
NHMOlocation not on record	3
Copenhagen, DK	3
NTNU-VMlocation not on record	2
TMPMlocation not on record	2
BioFokuslocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
MZLUlocation not on record	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
University of Guelphlocation not on record	1
IFR-DNFlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Biodiversity Institute of Ontariolocation not on record	1
CBDClocation not on record	1
NCMGlocation not on record	1

32 institutions · 349 of 479 vouchered records shown · 130 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA35 detections

Where the DNA of Anotylus insecatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys2

Countries8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map8 countries0

WaldrandRiparian Zone1.1. Boreal Forest|1. Forest & WoodlandHalbtrockenrasensavipohjainen ruderaattiTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 9.40–20.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)20.2 °C 13.2–24.8

Min temp (night)12.7 °C 4.50–15.5

Precipitation80.5 mm/mo 43.8–88.1

Air humidity57.7 % 55.1–59.8

Moisture balance-54.8 mm/mo -67.4–-37.4

Vapour deficit769 Pa 484–1,003

Wind speed3.30 m/s 2.60–4.00

Cloud cover40.8 % 34.8–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)