Anoplophora glabripennis

(Motschulsky, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Anoplophora

At a glance

Occurrence records416

Data sources10

Biological traits0

DNA specimens1 051

eDNA detections1 045

Sources10 archives

Databases and archives Anoplophora glabripennis's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility416 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 045 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 051 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF416 records

Environmental DNA1 datasets · 9 countries1 045 detections

DNA & barcodingBOLD1 051 specimens

Genome at a glanceGoaT · NCBI≈740 Mbp

01Narrative

The Asian long-horned beetle (Anoplophora glabripennis), also known as the starry sky, sky beetle, or ALB, is native to eastern China, and Korea. This species has now been accidentally introduced into the United States, where it was first discovered in 1996, as well as Canada, and several countries in Europe, including Austria, France, Germany, Italy and UK. This beetle is believed to have been spread from Asia in solid wood packaging material.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 051 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplophora glabripennis has left across the world's sequence archives.

At a glance

DNA specimens1 051

BINs1

Marker genes12

eDNA detections1 045

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P475 bp consensus610 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

101Cmostly conserved

127Tvariable

277Amostly conserved

290Cmostly conserved

293Amostly conserved

367Avariable

391Tmostly conserved

451Cmostly conserved

ATTTGGAAATTGATTAGTTCCATTAATACTAGGTGCCCCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTACTCCCGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes25

BIN1

Most divergent pair2.7%

EuropeN.AmericaOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoplophora maculariasame genus7.2%Anoplophora chinensissame genus8.0%Anoplophora beryllinasame genus8.7%Plectrodera scalatorsame family11.8%Myrmechixenus vaporariorumsame order13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_008221 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anoplophora glabripennis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈739 916 542 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anoplophora glabripennis0.74 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×GoaT · Animal Chromosome Counts Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.1% BUSCO

08Occurrence & distribution

Record type416 records

Wild obs. + sensor336

Museum / vouchered80

Origin

Introduced15

Range

Area of Occupancy AOO1 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 137≤1 km 51≤10 km 36>10 km 27

251 georeferenced · 85 without coordinates

Open the mapobservation + sensor336

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 1≤1 km 17≤10 km 18>10 km 4

40 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	12
Chiba, JP	11
Capital Normal University, College of Life Scienceslocation not on record	10
SOVTlocation not on record	9
Cornell University Insect Collectionlocation not on record	5
Helsinki, FI	4
Toronto, CA	4
Toyama, JP	3
New Haven, US	2
Cambridge, US	2
Toyota city nature sanctuarylocation not on record	2
Chicago, US	2
DPIlocation not on record	2
HUNMlocation not on record	1
Provincia di Livornolocation not on record	1
University Park, US	1

16 institutions · 71 of 80 vouchered records shown · 8 without an institution code

09Environmental DNA1 045 detections

Where the DNA of Anoplophora glabripennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 045

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 045 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C -2.50–16.1

Seasonal swing summer↔winter19.6 °C

Max temp (day)12.7 °C 0.9–21.2

Min temp (night)4.60 °C -7.30–13.0

Precipitation112 mm/mo 69.8–175

Air humidity59.8 % 58.0–60.2

Moisture balance21.7 mm/mo -17.8–118

Vapour deficit542 Pa 219–736

Wind speed3.10 m/s 2.50–6.90

Cloud cover46.7 % 41.1–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 71 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)