Anoplophora chinensis

(Forster, 1771) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Anoplophora

At a glance

Occurrence records1 822

Data sources8

Biological traits0

DNA specimens61

eDNA detections70

Sources8 archives

Databases and archives Anoplophora chinensis's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 822 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI70 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics61 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 822 records

Environmental DNA1 datasets · 3 countries70 detections

DNA & barcodingBOLD61 specimens

Genome at a glanceTreeOfSex · GoaT≈661 Mbp

01Narrative

The citrus long-horned beetle (Anoplophora chinensis) is a long-horned beetle native to Japan, China, Korea, and Southeast Asia where it is considered a serious pest. Several countries in Europe had been infested with this insect in the past, including Italy, Switzerland, Turkey, France, Germany, and Croatia. Each female citrus long-horned beetle can lay up to 200 eggs after mating; each egg is individually deposited in tree bark. After the beetle larva hatches, it chews into the tree, forming a tunnel that is then used as a place for pupation. From egg-laying to pupation and adult emergence can take one to two years. Infestations by the beetle can kill many different types of hardwood trees including Citrus, pecan, apple, Australian pine, Hibiscus, sycamore, willow, pear, mulberry, chinaberry, poplar, Litchi, kumquat, Japanese red cedar, oak, and Ficus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding61 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoplophora chinensis has left across the world's sequence archives.

At a glance

DNA specimens61

BINs1

Marker genes2

eDNA detections70

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P632 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

42Amostly conserved

48Cvariable

60Amostly conserved

78Tmostly conserved

81Cvariable

111Tmostly conserved

138Tmostly conserved

166Gmostly conserved

178Tmostly conserved

186Amostly conserved

252Gvariable

255Amostly conserved

278Gmostly conserved

282Gvariable

333Tmostly conserved

426Tvariable

435Amostly conserved

477Amostly conserved

501Amostly conserved

513Tmostly conserved

546Tmostly conserved

549Tmostly conserved

564Gmostly conserved

603Amostly conserved

ATAGTTGGAACATCTCTAAGATTTTTAATTCGATCAGAATTAGGTACCCCTGGCTCATTAATTGGAGATGATCAAATTTACAATGTAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes24

BIN1

Most divergent pair4.4%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoplophora maculariasame genus2.8%Anoplophora glabripennissame genus8.0%Anoplophora beryllinasame genus8.6%Phytoecia pubescenssame family13.5%Plagiohammus nitidussame family14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_029230 ↗ · 13 protein · 22 tRNA · 2 rRNA

NADH dehydrogenase subunit 2cytochrome c oxidase subunit Icytochrome c oxidase subunit IIATP synthase F0 subunit 8ATP synthase F0 subunit 6cytochrome c oxidase subunit IIINADH dehydrogenase subunit 3NADH dehydrogenase subunit 5NADH dehydrogenase subunit 4NADH dehydrogenase subunit 4LNADH dehydrogenase subunit 6cytochrome bNADH dehydrogenase subunit 116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceTreeOfSex · GoaT

The complete instruction manual Anoplophora chinensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈661 154 369 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anoplophora chinensis0.66 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×TreeOfSex · invert

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type1 822 records

Wild obs. + sensor1 788

Museum / vouchered34

Range

Area of Occupancy AOO5 420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 754≤1 km 249≤10 km 120>10 km 189

1 312 georeferenced · 476 without coordinates

Open the mapobservation + sensor1 788

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Institute of Biological Resourceslocation not on record	15
Museo Entomologico de Leonlocation not on record	1
San Francisco, US	1
Toronto, CA	1
NSMKlocation not on record	1

5 institutions · 19 of 34 vouchered records shown · 5 without an institution code

09Environmental DNA70 detections

Where the DNA of Anoplophora chinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found70

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 70 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–15.4

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C 9.60–17.8

Min temp (night)3.00 °C 3.00–11.0

Precipitation344 mm/mo 64.4–346

Air humidity64.9 % 58.0–64.9

Moisture balance263 mm/mo 21.7–263

Vapour deficit428 Pa 412–690

Wind speed2.90 m/s 2.40–2.90

Cloud cover44.6 % 41.1–50.6

CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anoplophora chinensis

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type1 822 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 822 records