Anopina ednana

(Kearfott, 1907) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Anopina

At a glance

Occurrence records304

Data sources8

Biological traits0

DNA specimens282

eDNA detections291

Sources8 archives

Databases and archives Anopina ednana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility304 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI291 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics282 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF304 records

Environmental DNA1 datasets · 2 countries291 detections

DNA & barcodingBOLD282 specimens

01Narrative

Anopina ednana is a moth of the family Tortricidae. It is found in eastern North America, including Maine, Massachusetts, New Hampshire, North Carolina, Ontario, Pennsylvania, Quebec, Tennessee and West Virginia.mothphotographersgroup The wingspan is 11–12 mm. It was named in honour of the scientific illustrator Edna L. Beutenmüller.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding282 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopina ednana has left across the world's sequence archives.

At a glance

DNA specimens282

BINs1

Marker genes1

eDNA detections291

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus253 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

228Gvariable

249Cmostly conserved

345Cvariable

367Gmostly conserved

546Tmostly conserved

567Avariable

612Tmostly conserved

613Gmostly conserved

614Amostly conserved

615Tmostly conserved

617Cmostly conserved

618Tmostly conserved

619Gmostly conserved

620Cmostly conserved

621Tmostly conserved

623Gmostly conserved

624Amostly conserved

626Gmostly conserved

627Amostly conserved

629Gmostly conserved

630Amostly conserved

631Gmostly conserved

632Amostly conserved

633Tmostly conserved

635Cmostly conserved

ACATTATATTTTATTTTTGGAATTTGATCTGGTATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAGTCCAGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.92%

Haplotypes10

BIN1

Most divergent pair4.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopina internacionanasame genus2.2%Anopina arizonanasame genus5.0%Anopina wrightisame genus6.4%Anopina hermanasame genus7.5%Anopina triangulanasame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type304 records

Wild obs. + sensor48

Museum / vouchered256

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 24≤1 km 10≤10 km 4>10 km 3

41 georeferenced · 7 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 256 records without

Open the institutions mapphysical evidence256

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	176
Cornell University Insect Collectionlocation not on record	10
St. Paul, US	8
Research Collection of Daniel Handfieldlocation not on record	1

4 institutions · 195 of 256 vouchered records shown · 61 without an institution code

09Environmental DNA291 detections

Where the DNA of Anopina ednana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found291

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 291 detections have coordinates

Open the map2 countries0

1. Forest & Woodland1. Forest & Woodland|1.1. Boreal ForestForest4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 16.1–18.6

Seasonal swing summer↔winter23.6 °C

Max temp (day)18.8 °C 18.8–23.2

Min temp (night)14.2 °C 14.2–16.6

Precipitation98.9 mm/mo 81.2–139

Air humidity66.5 % 58.5–66.7

Vapour deficit625 Pa 608–886

Cloud cover47.0 % 42.8–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 286 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)