Anopina triangulana

(Kearfott, 1908) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Anopina

At a glance

Occurrence records259

Data sources8

Biological traits0

DNA specimens36

eDNA detections36

Sources8 archives

Databases and archives Anopina triangulana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility259 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF259 records

Environmental DNA1 datasets · 2 countries36 detections

DNA & barcodingBOLD36 specimens

01Narrative

Anopina triangulana is a moth of the family Tortricidae. It is found in California in the United States.mothphotographersgroup The length of the forewings is 6.5–8 mm. Adult are pale grey mottled with dark grey. There is a well-defined dark triangle beyond the midcosta. Females have the distal half of the forewings mostly fuscous clouded, obscuring this discal triangle. The basal area is pale ochreous or tan. Adults are on wing from April to November.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopina triangulana has left across the world's sequence archives.

At a glance

DNA specimens36

BINs2

Marker genes1

eDNA detections36

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

7Gvariable

23Amostly conserved

85Cmostly conserved

184Tmostly conserved

238Tmostly conserved

266Cmostly conserved

287Tmostly conserved

292Tvariable

433Gmostly conserved

469Cmostly conserved

518Amostly conserved

519Amostly conserved

553Tmostly conserved

616Tmostly conserved

AACATTGTATTTTATTTTTGGAATTTGATCTGGTATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.85%

Haplotypes5

BINs2

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopina wrightisame genus6.4%Choristoneura luticostanasame family7.0%Anopina arizonanasame genus7.2%Anopina internacionanasame genus7.3%Anopina silvertonanasame genus7.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type259 records

Wild obs. + sensor216

Museum / vouchered43

Origin

Native4

Range

Area of Occupancy AOO384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 66≤1 km 30≤10 km 5>10 km 13

114 georeferenced · 102 without coordinates

Open the mapobservation + sensor216

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 7≤1 km 1≤10 km 16>10 km 10

34 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	25
Denver, US	5
Los Angeles, US	4
University of California, Davislocation not on record	4
New Haven, US	3
San Francisco, US	1
Colorado State Universitylocation not on record	1

7 institutions · 43 of 43 vouchered records shown

09Environmental DNA36 detections

Where the DNA of Anopina triangulana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map2 countries0

Marsh1. Forest & Woodland | 1.4. Temperate Forestfreshwater stream, and mediterranean climate…1. Forest & WoodlandCoastal Sage Scrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 15.9–22.4

Seasonal swing summer↔winter10.9 °C

Max temp (day)24.0 °C 18.7–30.4

Min temp (night)14.2 °C 11.2–17.9

Precipitation4.00 mm/mo 0.9–10.2

Air humidity55.4 % 45.3–75.9

Moisture balance-156 mm/mo

Vapour deficit936 Pa 467–1,436

Wind speed1.80 m/s

Cloud cover17.3 % 12.5–31.3

CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)