Anopheles triannulatus

Neiva & Pinto, 1922 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records1 874

Data sources5

Biological traits0

DNA specimens687

eDNA detections686

Sources5 archives

Databases and archives Anopheles triannulatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 874 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI686 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics687 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 874 records

Environmental DNA1 datasets · 4 countries686 detections

DNA & barcodingBOLD687 specimens

01Narrative

Anopheles triannulatus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1922 door Neiva & Pinto.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding687 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles triannulatus has left across the world's sequence archives.

At a glance

DNA specimens687

BINs2

Marker genes3

eDNA detections686

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P610 bp consensus288 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

43Tmostly conserved

76Tmostly conserved

91Cvariable

172Amostly conserved

175Amostly conserved

178Amostly conserved

190Amostly conserved

193Tmostly conserved

208Tvariable

223Tmostly conserved

238Amostly conserved

244Ghighly variable

289Avariable

295Gvariable

316Tmostly conserved

337Cvariable

346Amostly conserved

373Tvariable

397Tmostly conserved

406Amostly conserved

439Amostly conserved

463Tmostly conserved

499Amostly conserved

515Tmostly conserved

523Amostly conserved

580Avariable

589Cmostly conserved

595Gvariable

604Amostly conserved

607Cvariable

AGCTGGTATAGTTGGAACTTCATTAAGAATTTTAATTCGAGCTGAACTTGGTCATCCAGGAGCTTTTATTGGAGATGATCAAATTTATAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 102 variants.

Diversity (π)1.9%

Haplotypes102

BINs2

Most divergent pair10.2%

S.AmericaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles evansaesame genus5.7%Anopheles oswaldoisame genus6.1%Anopheles konderisame genus6.7%Anopheles albimanussame genus6.7%Anopheles oryzalimnetessame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS2

animal barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_037800 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 874 records

Wild obs. + sensor25

Museum / vouchered1 849

Range

Area of Occupancy AOO856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 22 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 13>10 km 5

18 georeferenced · 1 831 without coordinates

Open the institutions mapphysical evidence1 849

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut Pasteur de la Guyanelocation not on record	626
Washington, US	560
Museu Paraense Emílio Goeldilocation not on record	243
Fundação Oswaldo Cruzlocation not on record	186
Service Départemental de Désinfectionlocation not on record	80
UFPRlocation not on record	58
San Francisco, US	11
Institut Pasteur de Guyane et le Service de Santé des Arméeslocation not on record	10
Rapport sur le fontionnement technique - Institut Pasteur de la Guyanelocation not on record	7
IEPA/LACENlocation not on record	6
Service de Santé des Arméeslocation not on record	4
Rapport Annuel - Institut Pasteur de la Guyanelocation not on record	4
New Haven, US	3
Universidad Nacional de Cordoba, Centro de Investigaciones Entomologicas de Cordobalocation not on record	2

14 institutions · 1 800 of 1 849 vouchered records shown · 36 without an institution code

09Environmental DNA686 detections

Where the DNA of Anopheles triannulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found686

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 686 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 24.9–26.2

Seasonal swing summer↔winter3.60 °C

Max temp (day)29.6 °C 29.0–30.2

Min temp (night)22.3 °C 21.0–22.8

Precipitation222 mm/mo 144–454

Air humidity64.7 % 62.4–67.2

Moisture balance67.7 mm/mo 9.50–320

Vapour deficit1,175 Pa 1,085–1,175

Wind speed2.60 m/s 0.9–2.60

Cloud cover68.7 % 36.4–68.7

CHELSA 1981–2010, ~9 km grid, at location & month of 108 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anopheles triannulatus

At a glance

Sources5 archives

At a glance

Record type1 874 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 874 records