Anopheles albimanus

Wiedemann, 1820 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records3 362

Data sources10

Biological traits0

DNA specimens676

eDNA detections677

Sources10 archives

Databases and archives Anopheles albimanus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 362 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI677 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics676 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 362 records

Environmental DNA1 datasets · 8 countries677 detections

DNA & barcodingBOLD676 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈173 Mbp

01Narrative

Anopheles albimanus is a species of mosquito in the order Diptera. It is found in coastal Central and South America, the Caribbean, and Mexico. It is a generalist species and capable of wide dispersion. A. albimanus is a common malaria vector.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding676 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles albimanus has left across the world's sequence archives.

At a glance

DNA specimens676

BINs2

Marker genes3

eDNA detections677

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus531 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

22Gmostly conserved

28Amostly conserved

31Cmostly conserved

49Amostly conserved

50Cmostly conserved

61Amostly conserved

88Avariable

103Tmostly conserved

160Amostly conserved

181Amostly conserved

184Amostly conserved

206Tmostly conserved

250Cmostly conserved

271Tmostly conserved

316Gvariable

343Tmostly conserved

373Avariable

412Tmostly conserved

415Gmostly conserved

421Amostly conserved

466Amostly conserved

469Amostly conserved

472Amostly conserved

496Gvariable

508Gmostly conserved

520Tmostly conserved

529Cmostly conserved

542Tvariable

553Tmostly conserved

565Avariable

607Avariable

616Tvariable

628Amostly conserved

634Cvariable

646Cmostly conserved

AACATTATATTTTATTTTTGGGGCCTGAGCCGGAATAGTAGGAACTTCACTAAGAATTCTAATTCGAGCTGAACTAGGTCACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 34 commonest of 121 variants.

Diversity (π)1.7%

Haplotypes121

BINs2

Most divergent pair4.1%

N.AmericaS.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles triannulatussame genus6.7%Anopheles oswaldoisame genus6.8%Anopheles evansaesame genus6.8%Anopheles tadeisame genus6.9%Anopheles goeldiisame genus7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Anopheles albimanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈173 339 239 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Anopheles albimanus0.17 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome records6–62n range6median6mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 64×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Kitzmiller, J. B. (1963). "Mosquito Cytogenetics: A Review of the Literature, 1953-62." Bulletin of the World Health Organization 29(3): 345. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.5% BUSCO

08Occurrence & distribution

Record type3 362 records

Wild obs. + sensor485

Museum / vouchered2 877

Range

Area of Occupancy AOO3 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 2≤1 km 1>10 km 5

8 georeferenced · 477 without coordinates

Open the mapobservation + sensor485

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 1 074≤1 km 258≤10 km 186>10 km 22

1 540 georeferenced · 1 337 without coordinates

Open the institutions mapphysical evidence2 877

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	1 108
Ciudad de México, MX	585
Centro Regional de Investigación en Salud Pública, Instituto Nacional de Salud Públicalocation not on record	476
Tempe, US	229
New Haven, US	96
San Francisco, US	67
San Nicolás de los Garza, MX	57
Champaign, US	51
Chicago, US	28
CUlocation not on record	22
Instituto Nacional de Biodiversidad (INBio)location not on record	6
University of Queensland Insect Collectionlocation not on record	5
Wuzhou, CN	3
Secretaría de Salud de Guanajuatolocation not on record	3
Rapport Annuel - Institut Pasteur de la Guyanelocation not on record	3
Universidad Autonoma Agraria Antonio Narro, Unidad Lagunalocation not on record	2
Cambridge, US	1
NEON Biorepository at Arizona State Universitylocation not on record	1
Naturalis Biodiversity Centerlocation not on record	1
Mayagüez, PR	1
UFPRlocation not on record	1

21 institutions · 2 746 of 2 877 vouchered records shown · 99 without an institution code

09Environmental DNA677 detections

Where the DNA of Anopheles albimanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found677

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 677 detections have coordinates

Open the map8 countries0

cultivatedCropsgrasslandHerbaceouspastureHayevergreenForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 23.5–26.7

Seasonal swing summer↔winter2.80 °C

Max temp (day)28.8 °C 27.0–29.6

Min temp (night)22.9 °C 20.5–25.2

Precipitation200 mm/mo 51.8–227

Air humidity64.7 % 59.1–71.6

Moisture balance62.1 mm/mo

Vapour deficit1,175 Pa 952–1,330

Wind speed2.60 m/s

Cloud cover34.2 % 24.9–68.7

CHELSA 1981–2010, ~9 km grid, at location & month of 226 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anopheles albimanus

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 362 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 362 records