Anopheles sinensis

Wiedemann, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records795

Data sources9

Biological traits0

DNA specimens617

eDNA detections662

Sources9 archives

Databases and archives Anopheles sinensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility795 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI662 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics617 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF795 records

Environmental DNA1 datasets · 7 countries662 detections

DNA & barcodingBOLD617 specimens

Genome at a glanceGoaT · NCBI≈376 Mbp

01Narrative

Anopheles sinensis is a species of mosquito that transmits malaria as well as lymphatic filariasis. It is regarded as the most important vector of these human parasitic diseases in Southeast Asia. It is the primary vector of vivax malaria (Plasmodium vivax) in many regions. In China it also transmits the filalarial parasite (Wuchereria bancrofti), and arthropod roundworm (Romanomermis jingdeensis). In Japan it is also a vector of a roundworm Setaria digitata in sheep and goats. Because of its similarity with other Anopheles, it is now considered a species complex comprising at least four species. Its genome was sequenced in 2014.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding617 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles sinensis has left across the world's sequence archives.

At a glance

DNA specimens617

BINs1

Marker genes12

eDNA detections662

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P593 bp consensus598 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

92Tmostly conserved

152Avariable

173Cmostly conserved

191Amostly conserved

206Cmostly conserved

209Tmostly conserved

257Tmostly conserved

314Gmostly conserved

329Cvariable

332Amostly conserved

359Amostly conserved

401Gmostly conserved

458Tmostly conserved

464Amostly conserved

485Tmostly conserved

486Cmostly conserved

548Cmostly conserved

TTTTTGGAGCTTGAGCCGGAATAGTAGGAACTTCTTTAAGTATTCTAATTCGAGCTGAATTAGGTCATCCTGGTGCTTTTATTGGAGATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 40 commonest of 331 variants.

Diversity (π)1.1%

Haplotypes331

BIN1

Most divergent pair4.2%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles kleinisame genus1.9%Anopheles lesterisame genus2.7%Anopheles pseudopictussame genus2.9%Anopheles pullussame genus2.9%Anopheles hyrcanussame genus3.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_028016 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anopheles sinensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈375 763 635 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anopheles sinensis0.38 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.7% BUSCO

08Occurrence & distribution

Record type795 records

Wild obs. + sensor117

Museum / vouchered678

Range

Area of Occupancy AOO1 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 117 records without

Open the mapobservation + sensor117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 3≤10 km 23>10 km 7

33 georeferenced · 645 without coordinates

Open the institutions mapphysical evidence678

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MMaplocation not on record	215
Washington, US	113
Academy of Military Medical Scienceslocation not on record	81
Institute of Zoology, Chinese Academy of Scienceslocation not on record	41
San Francisco, US	14
East Lansing, US	13
Second Military Medical Collegelocation not on record	9
Champaign, US	4
Wuzhou, CN	3
Cambridge, US	2
SUMClocation not on record	1
QSBG/BMNHlocation not on record	1

12 institutions · 497 of 678 vouchered records shown · 178 without an institution code

09Environmental DNA662 detections

Where the DNA of Anopheles sinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found662

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 662 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 7.80–23.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 9.80–24.9

Min temp (night)3.10 °C 3.10–19.2

Precipitation13.8 mm/mo 13.8–168

Air humidity45.7 % 45.7–63.4

Moisture balance-95.2 mm/mo -95.2–51.3

Vapour deficit827 Pa 448–982

Wind speed4.50 m/s 2.10–4.50

Cloud cover24.1 % 24.1–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 380 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)