Anopheles hyrcanus

(Pallas, 1771) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records283

Data sources6

Biological traits0

DNA specimens109

eDNA detections53

Sources6 archives

Databases and archives Anopheles hyrcanus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility283 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics109 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF283 records

Environmental DNA1 datasets · 7 countries53 detections

DNA & barcodingBOLD109 specimens

01Narrative

Anopheles hyrcanus is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1771 door Pallas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding109 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles hyrcanus has left across the world's sequence archives.

At a glance

DNA specimens109

BINs4

Marker genes2

eDNA detections53

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P624 bp consensus99 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

46Tmostly conserved

79Amostly conserved

82Amostly conserved

157Amostly conserved

158Cmostly conserved

208Tmostly conserved

232Amostly conserved

235Tvariable

353Cmostly conserved

380Tmostly conserved

394Tmostly conserved

448Gvariable

452Tmostly conserved

508Amostly conserved

514Tmostly conserved

532Cmostly conserved

559Amostly conserved

568Cmostly conserved

598Cvariable

616Cvariable

622Tmostly conserved

TTTAAGTATTCTAATTCGAGCTGAATTAGGTCATCCTGGTGCTTTTATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCACATGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes12

BINs4

Most divergent pair1.6%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles pullussame genus2.1%Anopheles lesterisame genus3.1%Anopheles sinensissame genus3.2%Anopheles belenraesame genus3.4%Anopheles liangshanensissame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type283 records

Wild obs. + sensor192

Museum / vouchered91

Range

Area of Occupancy AOO656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 17≤1 km 4≤10 km 16>10 km 6

43 georeferenced · 149 without coordinates

Open the mapobservation + sensor192

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 11≤1 km 16≤10 km 10>10 km 1

38 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	7
University of Queensland Insect Collectionlocation not on record	7
New Haven, US	3
Second Military Medical Collegelocation not on record	2
Academy of Military Medical Scienceslocation not on record	1
San Francisco, US	1

6 institutions · 21 of 91 vouchered records shown · 38 without an institution code

09Environmental DNA53 detections

Where the DNA of Anopheles hyrcanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 7.50–11.8

Seasonal swing summer↔winter21.3 °C

Max temp (day)15.1 °C 12.1–16.2

Min temp (night)4.40 °C 0.8–7.30

Precipitation57.6 mm/mo 14.4–86.2

Air humidity62.3 % 50.9–62.5

Moisture balance-9.50 mm/mo -49.4–14.3

Vapour deficit552 Pa 477–708

Wind speed2.10 m/s 1.80–4.60

Cloud cover41.8 % 32.4–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)