Anopheles rufipes

(Gough, 1910) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records236

Data sources5

Biological traits0

DNA specimens69

eDNA detections81

Sources5 archives

Databases and archives Anopheles rufipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility236 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI81 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics69 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF236 records

Environmental DNA2 datasets · 7 countries81 detections

DNA & barcodingBOLD69 specimens

01Narrative

Anopheles rufipes is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1910 door Gough.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding69 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles rufipes has left across the world's sequence archives.

At a glance

DNA specimens69

BINs4

Marker genes1

eDNA detections81

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus68 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

22Amostly conserved

43Amostly conserved

49Cmostly conserved

79Amostly conserved

82Tmostly conserved

85Tmostly conserved

103Cmostly conserved

181Gvariable

196Amostly conserved

199Gmostly conserved

212Cmostly conserved

220Cmostly conserved

226Tmostly conserved

265Amostly conserved

271Tvariable

283Amostly conserved

284Cmostly conserved

316Amostly conserved

337Amostly conserved

340Cvariable

355Amostly conserved

358Amostly conserved

370Cmostly conserved

373Amostly conserved

388Amostly conserved

407Cmostly conserved

433Amostly conserved

466Amostly conserved

478Amostly conserved

481Tmostly conserved

496Gmostly conserved

499Amostly conserved

508Cmostly conserved

562Tmostly conserved

577Amostly conserved

581Cmostly conserved

583Amostly conserved

586Gvariable

595Cmostly conserved

596Cmostly conserved

616Tvariable

622Amostly conserved

623Gmostly conserved

628Gvariable

631Amostly conserved

634Cmostly conserved

637Amostly conserved

646Tmostly conserved

652Tmostly conserved

AACTTTATATTTTATCTTCGGAGCTTGAGCAGGAATAGTAGGAACTTCCTTAAGAATTCTTATTCGAGCAGAATTAGGACATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes29

BINs4

Most divergent pair6.2%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles funestussame genus8.5%Anopheles longipalpissame genus9.4%Anopheles paludissame genus9.5%Anopheles coustanisame genus9.6%Anopheles ziemannisame genus9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type236 records

Wild obs. + sensor176

Museum / vouchered60

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 176 records without

Open the mapobservation + sensor176

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 10

10 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	33
New Haven, US	10
Cape Town, ZA	1
University of Queensland Insect Collectionlocation not on record	1

4 institutions · 45 of 60 vouchered records shown · 15 without an institution code

09Environmental DNA81 detections

Where the DNA of Anopheles rufipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found81

Studies independent surveys2

Countries7

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 81 detections have coordinates

Open the map7 countries0

Sahalian villagehighland, forest, field, marshhighland, marshMopaneÂ Shrubveldhighlands, mashy, scrubreared

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 21.9–28.6

Seasonal swing summer↔winter5.50 °C

Max temp (day)28.1 °C 25.7–34.8

Min temp (night)21.3 °C 17.9–22.8

Precipitation95.1 mm/mo 46.5–179

Air humidity58.3 % 44.5–63.4

Moisture balance-50.6 mm/mo -141–30.3

Vapour deficit1,213 Pa 999–2,193

Wind speed2.70 m/s 1.70–3.70

Cloud cover30.1 % 10.0–39.4

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)