Anopheles coustani

Laveran, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records263

Data sources7

Biological traits0

DNA specimens343

eDNA detections49

Sources7 archives

Databases and archives Anopheles coustani's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility263 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics343 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF263 records

Environmental DNA1 datasets · 3 countries49 detections

DNA & barcodingBOLD343 specimens

Genome at a glanceGoaT · NCBI≈270 Mbp

01Narrative

Anopheles coustani is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1900 door Laveran.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding343 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles coustani has left across the world's sequence archives.

At a glance

DNA specimens343

BINs3

Marker genes4

eDNA detections49

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P614 bp consensus337 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

154Cmostly conserved

166Avariable

181Gvariable

235Cmostly conserved

238Tmostly conserved

266Tmostly conserved

268Amostly conserved

271Tmostly conserved

286Avariable

316Amostly conserved

322Gmostly conserved

328Amostly conserved

340Tmostly conserved

343Tmostly conserved

364Tmostly conserved

373Amostly conserved

379Amostly conserved

388Amostly conserved

412Amostly conserved

415Tmostly conserved

433Amostly conserved

472Tmostly conserved

475Tmostly conserved

514Tmostly conserved

517Amostly conserved

553Tmostly conserved

565Amostly conserved

574Tmostly conserved

595Tmostly conserved

604Tmostly conserved

TACTTTATATTTTATTTTTGGAGCTTGAGCCGGAATAGTAGGAACTTCTTTAAGTATTCTAATTCGAGCTGAATTAGGTCATCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 58 variants.

Diversity (π)1.4%

Haplotypes58

BINs3

Most divergent pair2.0%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles paludissame genus2.8%Anopheles pseudopictussame genus3.7%Anopheles hyrcanussame genus4.1%Anopheles lesterisame genus4.1%Anopheles peditaeniatussame genus4.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-3P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_064611 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anopheles coustani carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈269 983 652 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anopheles coustani0.27 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.4% BUSCO

08Occurrence & distribution

Record type263 records

Wild obs. + sensor128

Museum / vouchered135

Range

Area of Occupancy AOO348 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 3≤1 km 1≤10 km 2>10 km 6

12 georeferenced · 116 without coordinates

Open the mapobservation + sensor128

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 24>10 km 3

27 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	52
San Francisco, US	14
New Haven, US	9
Cape Town, ZA	8
Durban Natural Science Museumlocation not on record	7
East Lansing, US	4
University of Queensland Insect Collectionlocation not on record	1

7 institutions · 95 of 135 vouchered records shown · 39 without an institution code

09Environmental DNA49 detections

Where the DNA of Anopheles coustani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 21.6–25.5

Seasonal swing summer↔winter2.10 °C

Max temp (day)29.4 °C 28.3–30.5

Min temp (night)20.5 °C 15.6–21.2

Precipitation105 mm/mo 14.0–215

Air humidity59.5 % 48.6–67.6

Moisture balance-41.7 mm/mo -122–84.7

Vapour deficit1,162 Pa 1,000–1,480

Wind speed1.70 m/s 0.9–2.50

Cloud cover38.9 % 23.0–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)