Anopheles pharoensis

Theobald, 1901 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Anopheles

At a glance

Occurrence records1 277

Data sources8

Biological traits0

DNA specimens71

eDNA detections69

Sources8 archives

Databases and archives Anopheles pharoensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 277 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics71 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 277 records

Environmental DNA1 datasets · 3 countries69 detections

DNA & barcodingBOLD71 specimens

Genome at a glanceGoaT · NCBI≈328 Mbp

01Narrative

Anopheles pharoensis is een muggensoort uit de familie van de steekmuggen (Culicidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1901 door Theobald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding71 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anopheles pharoensis has left across the world's sequence archives.

At a glance

DNA specimens71

BINs2

Marker genes1

eDNA detections69

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus69 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

22Amostly conserved

76Gmostly conserved

79Tmostly conserved

82Cmostly conserved

166Gmostly conserved

181Gmostly conserved

202Tmostly conserved

217Amostly conserved

220Tmostly conserved

250Tvariable

271Gmostly conserved

286Amostly conserved

287Cvariable

316Avariable

355Cmostly conserved

358Amostly conserved

373Gmostly conserved

493Avariable

499Amostly conserved

526Avariable

535Gvariable

562Tmostly conserved

598Amostly conserved

607Gmostly conserved

634Cmostly conserved

646Cmostly conserved

AACTTTATATTTTATCTTTGGAGCTTGAGCTGGAATAGTAGGAACCTCTTTAAGAATCCTAATTCGAGCTGAATTGGGTCACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 41 variants.

Diversity (π)1.4%

Haplotypes41

BINs2

Most divergent pair2.7%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anopheles kochisame genus10.0%Anopheles coustanisame genus10.1%Anopheles darlingisame genus10.3%Anopheles melassame genus10.3%Anopheles medialissame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anopheles pharoensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈327 595 878 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anopheles pharoensis0.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.5% BUSCO

08Occurrence & distribution

Record type1 277 records

Wild obs. + sensor1 204

Museum / vouchered73

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 1 203 without coordinates

Open the mapobservation + sensor1 204

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 14

14 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	24
New Haven, US	14
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

3 institutions · 39 of 73 vouchered records shown · 34 without an institution code

09Environmental DNA69 detections

Where the DNA of Anopheles pharoensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found69

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 69 detections have coordinates

Open the map3 countries0

Sahalian villageSahelian Village

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.7 °C 23.7–29.2

Seasonal swing summer↔winter10.0 °C

Max temp (day)35.0 °C 28.2–35.3

Min temp (night)22.2 °C 18.7–22.8

Precipitation48.8 mm/mo 46.5–105

Air humidity43.9 % 43.3–57.7

Moisture balance-137 mm/mo -150–-25.0

Vapour deficit2,267 Pa 1,224–2,298

Wind speed3.40 m/s 3.10–3.70

Cloud cover17.0 % 16.9–33.6

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anopheles pharoensis

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 277 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 3 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 277 records