Anonyx sarsi

Steele & Brunel, 1968 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Uristidae/Anonyx

At a glance

Occurrence records818

Data sources8

Biological traits2

DNA specimens49

eDNA detections705

Sources8 archives

Databases and archives Anonyx sarsi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility401 records↗

OBISOcean Biodiversity Information System417 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI705 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS818 records

Environmental DNA3 datasets · 6 countries705 detections

DNA & barcodingBOLD49 specimens

01Narrative

Anonyx sarsi is een vlokreeftensoort uit de familie van de Uristidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1968 door Steele & Brunel.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anonyx sarsi has left across the world's sequence archives.

At a glance

DNA specimens49

BINs2

Marker genes1

eDNA detections705

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus45 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

67Avariable

103Tmostly conserved

127Avariable

143Gvariable

163Tvariable

178Cvariable

181Avariable

220Avariable

263Cmostly conserved

290Cvariable

307Tvariable

319Avariable

322Tmostly conserved

334Gvariable

340Cvariable

361Cvariable

370Gvariable

373Avariable

385Tvariable

403Amostly conserved

430Amostly conserved

433Tvariable

482Cvariable

511Amostly conserved

523Tvariable

562Tvariable

565Avariable

622Tmostly conserved

TACCCTTTATTTTATTCTAGGTGCTTGAGCAAGTGCTATTGGAACATCCTTAAGATTAATTATCCGATCCGAACTTAGAACTCCTAGTTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes12

BINs2

Most divergent pair4.1%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anonyx nugaxsame genus11.1%Anonyx lilljeborgisame genus12.1%Anonyx makarovisame genus13.1%Anonyx ochoticussame genus13.4%Anonyx eoussame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type818 records

Wild obs. + sensor307

Museum / vouchered422

Other89

Range

Area of Occupancy AOO1 440 km²

Depth

0–200 m sunlit302

200–1000 m twilight50

1–4 km midnight2

>4 km abyssal0

median 53 m · max 2 800 m · 354 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 32≤1 km 76≤10 km 36

144 georeferenced · 163 without coordinates

Open the mapobservation + sensor307

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 1

3 georeferenced · 419 without coordinates

Open the institutions mapphysical evidence422

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	52
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	35
Maurice Lamontagne Institutelocation not on record	26
Tromsø, NO	17
Stockholm, SE	16
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Assiniboine Park Conservancylocation not on record	5
The Atlantic reference Centrelocation not on record	4
Saint John, CA	4
New Haven, US	3
Dalhousie University, Dept of Fisheries and Oceanslocation not on record	3
Instytut Oceanologii Polskiej Akademii Nauklocation not on record	2
486location not on record	2
Institut Francais pour l'Etude de la Merlocation not on record	2
Bergen, NO	1
Edmonton, CA	1
Copenhagen, DK	1
Toronto, CA	1
Observatoire Océanologique de Banyuls-Sur-Mer; Laboratoire d'Océanographie Biologiquelocation not on record	1

19 institutions · 185 of 422 vouchered records shown · 60 without an institution code

09Environmental DNA705 detections

Where the DNA of Anonyx sarsi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found705

Studies independent surveys3

Countries6

Verifiable raw sequence linked657

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 705 detections have coordinates

Open the map6 countries0

Marinerocky intertidal

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.60 °C -11.2–11.4

Seasonal swing summer↔winter35.6 °C

Max temp (day)9.60 °C -8.80–15.5

Min temp (night)3.60 °C -13.3–8.80

Precipitation89.4 mm/mo 31.1–116

Air humidity62.0 % 59.3–69.7

Moisture balance29.6 mm/mo

Vapour deficit372 Pa 78.7–521

Wind speed4.40 m/s

Cloud cover51.2 % 44.1–61.2

CHELSA 1981–2010, ~9 km grid, at location & month of 703 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)