Anonyx nugax

(Phipps, 1774) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Uristidae/Anonyx

At a glance

Occurrence records3 935

Data sources8

Biological traits2

DNA specimens139

eDNA detections103

Sources8 archives

Databases and archives Anonyx nugax's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 335 records↗

OBISOcean Biodiversity Information System1 600 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI103 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics139 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~26.41 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS3 935 records

Environmental DNA1 datasets · 3 countries103 detections

DNA & barcodingBOLD139 specimens

Genome at a glanceGoaT26.4 Gbp

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding139 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anonyx nugax has left across the world's sequence archives.

At a glance

DNA specimens139

BINs5

Marker genes1

eDNA detections103

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus133 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 60 variable positions, in barcode order

22Tvariable

82Amostly conserved

92Cmostly conserved

97Tmostly conserved

103Tmostly conserved

115Tmostly conserved

145Tvariable

181Gmostly conserved

197Cmostly conserved

199Amostly conserved

202Gvariable

217Tmostly conserved

220Avariable

226Cmostly conserved

238Amostly conserved

263Tmostly conserved

265Amostly conserved

266Cmostly conserved

268Cmostly conserved

278Tmostly conserved

280Amostly conserved

292Gmostly conserved

325Amostly conserved

328Tvariable

337Tvariable

343Avariable

347Cmostly conserved

352Tmostly conserved

361Amostly conserved

373Amostly conserved

379Amostly conserved

388Amostly conserved

397Cmostly conserved

400Gvariable

403Amostly conserved

412Avariable

415Gmostly conserved

460Tmostly conserved

463Cmostly conserved

466Amostly conserved

469Cmostly conserved

472Amostly conserved

481Avariable

484Cmostly conserved

500Cmostly conserved

511Avariable

517Gmostly conserved

544Amostly conserved

547Cmostly conserved

548Tmostly conserved

553Tmostly conserved

556Tmostly conserved

571Tmostly conserved

577Amostly conserved

586Tmostly conserved

598Tvariable

619Tmostly conserved

625Amostly conserved

634Tmostly conserved

643Gmostly conserved

TACCCTTTATTTTATTCTAGGTGCTTGAGCAAGTGCCATCGGAACATCCCTAAGATTAATTATCCGGTCTGAACTTAGAACACCTAGTTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes18

BINs5

Most divergent pair14.7%

N.AmericaOtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anonyx sarsisame genus11.1%Anonyx makarovisame genus12.4%Anonyx ochoticussame genus13.7%Anonyx lilljeborgisame genus14.4%Anonyx eoussame genus14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Anonyx nugax carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size26 406 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Anonyx nugax26.41 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type3 935 records

Wild obs. + sensor2 825

Museum / vouchered1 017

Other93

Range

Area of Occupancy AOO7 548 km²

Depth

0–200 m sunlit499

200–1000 m twilight797

1–4 km midnight192

>4 km abyssal18

median 273.6 m · max 10 000 m · 1 506 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 30≤1 km 7≤10 km 3>10 km 1

41 georeferenced · 2 784 without coordinates

Open the mapobservation + sensor2 825

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 10≤1 km 64≤10 km 19>10 km 10

103 georeferenced · 914 without coordinates

Open the institutions mapphysical evidence1 017

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	248
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	98
Tromsø, NO	83
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	83
Norwegian Institute of Marine Researchlocation not on record	72
Washington, US	43
University of Guelph, Centre for Biodiversity Genomicslocation not on record	19
ArcODlocation not on record	17
Edmonton, CA	17
Maurice Lamontagne Institutelocation not on record	17
CASlocation not on record	15
Assiniboine Park Conservancylocation not on record	14
University of Oslo (UiO)location not on record	14
Instytut Oceanologii Polskiej Akademii Nauklocation not on record	13
NTNU-VMlocation not on record	11
Bergen, NO	10
Cambridge, US	8
ArCODlocation not on record	7
IOPASlocation not on record	6
P.P. Shirshov Institute of Oceanologylocation not on record	6
South Kensington, GB	6
Toronto, CA	5
Christian-Albrechts-University Kiel; Leibniz Institute of Marine Sciences; Marine Ecology Division; Fishery Biology sectionlocation not on record	4
Museum für Naturkunde Berlin (Zoological Collections)location not on record	3
National Marine Biodiversity Institute of Korealocation not on record	2
Dalhousie University, Dept of Fisheries and Oceanslocation not on record	2
Institute of Marine Researchlocation not on record	2
Canadian Museum of Naturelocation not on record	1
New Haven, US	1
The Atlantic reference Centrelocation not on record	1
Helsinki, FI	1

31 institutions · 829 of 1 017 vouchered records shown · 84 without an institution code

09Environmental DNA103 detections

Where the DNA of Anonyx nugax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found103

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 103 detections have coordinates

Open the map3 countries0

suprabenthicMarine9. Marine - Neritic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median3.50 °C -27.0–8.60

Seasonal swing summer↔winter32.9 °C

Max temp (day)5.50 °C -24.2–12.6

Min temp (night)1.80 °C -30.2–5.20

Precipitation63.3 mm/mo 20.0–97.4

Air humidity68.5 % 60.6–81.7

Vapour deficit238 Pa 20.6–444

Cloud cover60.7 % 42.1–66.9

CHELSA 1981–2010, ~9 km grid, at location & month of 93 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anonyx nugax

At a glance

Sources8 archives

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Record type3 935 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 935 records