Anoncia conia

(Walsingham, 1907) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Cosmopterigidae/Anoncia

At a glance

Occurrence records23

Data sources7

Biological traits0

DNA specimens10

eDNA detections11

Sources7 archives

Databases and archives Anoncia conia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF23 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD10 specimens

01Narrative

Anoncia conia is a moth in the family Cosmopterigidae. It is found in California, United States.mothphotographersgroup The wingspan is 14–16 mm. The forewings are whitish cinereous (ash-gray), dusted with brownish fuscous. The hindwings are cinereous, with a slight brownish tinge.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anoncia conia has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.30%

Haplotypes1

BIN1

Where individuals differ — all 8 variable positions, in barcode order

64Tmostly conserved

166Amostly conserved

178Cmostly conserved

226Tmostly conserved

235Tmostly conserved

238Tmostly conserved

361Tmostly conserved

625Amostly conserved

TACATTATATTTTATTTTCGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anoncia sphacelinasame genus7.8%Archanara neuricasame order8.7%Anoncia nacliasame genus8.7%Aedia squamosasame order9.1%Eremochroa alphitiassame order9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type23 records

Wild obs. + sensor4

Museum / vouchered19

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	12
San Diego, US	6
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

3 institutions · 19 of 19 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Anoncia conia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.4. Temperate ForestMarsh

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 16.6–24.6

Seasonal swing summer↔winter9.90 °C

Max temp (day)23.3 °C 19.0–32.8

Min temp (night)16.7 °C 11.6–18.5

Precipitation6.10 mm/mo 1.70–8.30

Air humidity58.1 % 48.1–68.0

Moisture balance-151 mm/mo

Vapour deficit789 Pa 636–1,558

Wind speed2.60 m/s

Cloud cover16.1 % 12.5–26.9

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)