Archanara neurica

Hübner · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Archanara

At a glance

Occurrence records2 059

Data sources7

Biological traits2

DNA specimens31

eDNA detections32

Sources7 archives

Databases and archives Archanara neurica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 059 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 059 records

Environmental DNA1 datasets · 9 countries32 detections

DNA & barcodingBOLD31 specimens

01Narrative

Archanara neurica, the white-mantled wainscot, is a nocturnal moth of the family Noctuidae described by Jacob Hübner in 1808. It is found in Austria, Belgium, Bosnia and Herzegovina, Great Britain, Bulgaria, Croatia, the Czech Republic, Denmark, France, Germany, Hungary, Italy, Latvia, Liechtenstein, North Macedonia, Poland, Romania, Sicily, Slovakia, Slovenia, Switzerland, the Netherlands and Serbia.Fauna Europaea In the UK, its only regular sites are at RSPB Minsmere and Walberswick National Nature Reserve in Suffolk.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Archanara neurica has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes1

eDNA detections32

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

37Amostly conserved

262Gvariable

616Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes4

BIN1

Most divergent pair0.46%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mniotype solierisame family4.6%Eremohadena marianasame family4.7%Parapamea buffaloensissame family4.9%Ulochlaena hirtasame family4.9%Gortyna hethiticasame family5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 059 records

Wild obs. + sensor1 109

Museum / vouchered902

Other48

Origin

Native199

Range

Area of Occupancy AOO2 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 167≤1 km 47≤10 km 709

923 georeferenced · 186 without coordinates

Open the mapobservation + sensor1 109

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 240≤1 km 124≤10 km 492>10 km 2

858 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence902

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	646
Provincia di Livornolocation not on record	30
Zürich, CH	26
Natural History Museum Rotterdamlocation not on record	25
SFRAlocation not on record	16
Salzburg, AT	13
Podgorica, ME	10
Paro, BT	9
Tartu, EE	9
Bern, CH	7
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
Frauenfeld, CH	4
Nijmegen, NL	4
ZSMlocation not on record	3
Archäologie und Museum Baselland - Museum.BLlocation not on record	2
Tallinn, EE	2
Museum zu Allerheiligen Schaffhausenlocation not on record	2
NHMOlocation not on record	2
Naturmuseum Oltenlocation not on record	2
Geneva, CH	2
Dhaka, BD	2
SLU Artdatabankenlocation not on record	1
UMUlocation not on record	1
ZMAAlocation not on record	1
ЗМКУlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
DABUHlocation not on record	1

27 institutions · 827 of 902 vouchered records shown · 75 without an institution code

09Environmental DNA32 detections

Where the DNA of Archanara neurica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map9 countries0

garden

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 7.70–21.9

Seasonal swing summer↔winter17.0 °C

Max temp (day)19.7 °C 11.5–24.5

Min temp (night)13.0 °C 3.20–17.2

Precipitation112 mm/mo 29.7–140

Air humidity60.6 % 55.3–62.3

Moisture balance9.60 mm/mo -136–51.6

Vapour deficit773 Pa 434–1,066

Wind speed3.10 m/s 1.80–4.10

Cloud cover38.7 % 32.1–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Archanara neurica

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 059 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 059 records