Anomis illita

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Anomis

At a glance

Occurrence records474

Data sources7

Biological traits0

DNA specimens165

eDNA detections170

Sources7 archives

Databases and archives Anomis illita's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility474 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI170 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics165 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF474 records

Environmental DNA1 datasets · 8 countries170 detections

DNA & barcodingBOLD165 specimens

01Narrative

Anomis illita, known generally as the okra leafworm or illita anomis moth, is a moth species in the family Erebidae. It is found in North America. The MONA or Hodges number for Anomis illita is 8551.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding165 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomis illita has left across the world's sequence archives.

At a glance

DNA specimens165

BINs1

Marker genes1

eDNA detections170

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus157 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

514Tmostly conserved

550Gvariable

AACTCTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCTTTAAGTATACTTATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes15

BIN1

Most divergent pair0.61%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anomis impastasame genus7.3%Anomis cataggelussame genus7.3%Anomis luridulasame genus7.3%Anomis texanasame genus7.6%Anomis arcinasame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type474 records

Wild obs. + sensor236

Museum / vouchered238

Range

Area of Occupancy AOO744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 125≤1 km 26≤10 km 18>10 km 17

186 georeferenced · 50 without coordinates

Open the mapobservation + sensor236

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤1 km 5≤10 km 15>10 km 2

22 georeferenced · 216 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	199
New Haven, US	8
Mississippi State, US	7
Cambridge, US	6
University of Pennsylvanialocation not on record	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
ZSMlocation not on record	1

7 institutions · 231 of 238 vouchered records shown · 7 without an institution code

09Environmental DNA170 detections

Where the DNA of Anomis illita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found170

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 170 detections have coordinates

Open the map8 countries0

1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 23.1–26.2

Seasonal swing summer↔winter2.50 °C

Max temp (day)28.3 °C 26.1–29.7

Min temp (night)23.1 °C 20.2–23.9

Precipitation193 mm/mo 65.5–369

Air humidity65.4 % 63.0–70.9

Moisture balance45.3 mm/mo -87.3–295

Vapour deficit1,141 Pa 822–1,174

Wind speed1.80 m/s 1.40–5.30

Cloud cover38.7 % 22.1–39.1

CHELSA 1981–2010, ~9 km grid, at location & month of 166 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)