Anomis luridula

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Anomis

At a glance

Occurrence records758

Data sources7

Biological traits0

DNA specimens312

eDNA detections313

Sources7 archives

Databases and archives Anomis luridula's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility758 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI313 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics312 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF758 records

Environmental DNA1 datasets · 5 countries313 detections

DNA & barcodingBOLD312 specimens

01Narrative

Anomis luridula is a moth species in the family Erebidae. It is found in North America. The MONA or Hodges number for Anomis luridula is 8549.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding312 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomis luridula has left across the world's sequence archives.

At a glance

DNA specimens312

BINs1

Marker genes1

eDNA detections313

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus310 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

214Amostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTATACTTATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes36

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anomis arcinasame genus5.2%Anomis cataggelussame genus5.5%Anomis texanasame genus6.1%Anomis oedemasame genus6.4%Anomis impastasame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type758 records

Wild obs. + sensor5

Museum / vouchered753

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 1

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 4≤10 km 35

39 georeferenced · 714 without coordinates

Open the institutions mapphysical evidence753

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	492
Tapachula, MX	142
Cambridge, US	34
Ciudad de México, MX	4
University of Pennsylvanialocation not on record	1
Area de Conservacion Guanacastelocation not on record	1
New Haven, US	1

7 institutions · 675 of 753 vouchered records shown · 78 without an institution code

09Environmental DNA313 detections

Where the DNA of Anomis luridula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found313

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 313 detections have coordinates

Open the map5 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.9. Subtropical/Tropic…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 21.6–26.8

Seasonal swing summer↔winter2.40 °C

Max temp (day)26.9 °C 24.8–31.1

Min temp (night)21.7 °C 18.7–23.3

Precipitation288 mm/mo 65.5–423

Air humidity70.5 % 62.6–75.5

Moisture balance158 mm/mo -98.3–295

Vapour deficit867 Pa 700–1,301

Wind speed2.30 m/s 1.20–4.00

Cloud cover31.8 % 15.1–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 305 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)