Anomis figlina

Butler, 1889 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Anomis

At a glance

Occurrence records43

Data sources7

Biological traits0

DNA specimens8

eDNA detections11

Sources7 archives

Databases and archives Anomis figlina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF43 records

Environmental DNA1 datasets · 3 countries11 detections

DNA & barcodingBOLD8 specimens

01Narrative

Anomis figlina is a moth of the family Erebidae first described by Arthur Gardiner Butler in 1889. It is found in Sri Lanka, India, Australia and Japan. Its wingspan is about 4 cm. The forewings are rusty brown with a purplish sheen. A black-outlined dark area is found near the middle of the wing. Several dark zigzag transverse lines also found on the forewings. The hindwings pale grey brown. Caterpillars are known to feed on many Greiwa species such as Grewia paniculata and Grewia tiliaefolia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomis figlina has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections11

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

499Gmostly conserved

577Gvariable

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGAATGTTAATTCGAGCAGAATTAGGAAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes3

BIN1

Most divergent pair0.30%

OceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rusicada revocanssame family7.4%Anomis erosasame genus7.6%Rusicada combinanssame family7.6%Anomis combinanssame genus7.8%Rusicada albitibiasame family7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type43 records

Wild obs. + sensor8

Museum / vouchered35

Origin

Native2

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 4

7 georeferenced · 1 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 35 records without

Open the institutions mapphysical evidence35

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	25
Washington, US	4
SUVlocation not on record	2

3 institutions · 31 of 35 vouchered records shown · 4 without an institution code

09Environmental DNA11 detections

Where the DNA of Anomis figlina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map3 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 26.4–27.7

Seasonal swing summer↔winter3.50 °C

Max temp (day)28.8 °C 27.7–29.2

Min temp (night)24.8 °C 23.2–26.7

Precipitation300 mm/mo 137–462

Air humidity65.3 % 64.8–70.7

Moisture balance123 mm/mo

Vapour deficit1,193 Pa 1,024–1,301

Wind speed3.70 m/s

Cloud cover75.3 % 45.3–82.3

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)