Anomis erosa

Hübner, 1818 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Anomis

At a glance

Occurrence records524

Data sources7

Biological traits0

DNA specimens62

eDNA detections72

Sources7 archives

Databases and archives Anomis erosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility524 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI72 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics62 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF524 records

Environmental DNA1 datasets · 6 countries72 detections

DNA & barcodingBOLD62 specimens

01Narrative

Anomis erosa, the yellow scallop moth or abutilon moth, is a moth of the family Erebidae. The species was first described by Jacob Hübner in 1821. It is found in south-eastern North America. It is mostly a southern species, but migrants reach Manitoba, Quebec and Maine. The wingspan is about 27 mm. The larvae feed on cotton, Hibiscus or rose of Sharon, hollyhock, marsh mallow, okra, rose-mallow, velvet leaf and other Malvaceae species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding62 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anomis erosa has left across the world's sequence archives.

At a glance

DNA specimens62

BINs1

Marker genes1

eDNA detections72

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus62 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

616Cmostly conserved

628Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGTATATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes11

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anomis flavasame genus6.4%Anomis scitipennissame genus6.8%Mesogenea variansame family6.8%Rusicada albitibiasame family7.0%Mesogenea varianssame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type524 records

Wild obs. + sensor206

Museum / vouchered318

Range

Area of Occupancy AOO988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 81≤1 km 37≤10 km 25>10 km 18

161 georeferenced · 45 without coordinates

Open the mapobservation + sensor206

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 2≤1 km 28≤10 km 136>10 km 42

208 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence318

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	73
National Biodiversity Institute, Costa Ricalocation not on record	42
Cambridge, US	40
East Lansing, US	34
New Haven, US	29
King Saud Universitylocation not on record	29
Durban Natural Science Museumlocation not on record	13
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	9
St. Paul, US	8
Georgia Museum of Natural Historylocation not on record	7
CUlocation not on record	6
Washington, US	4
Chicago, US	3
PUC-RSlocation not on record	3
Ciudad de México, MX	2
Tapachula, MX	2
UDlocation not on record	1

17 institutions · 305 of 318 vouchered records shown · 13 without an institution code

09Environmental DNA72 detections

Where the DNA of Anomis erosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found72

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 72 detections have coordinates

Open the map6 countries0

1. Forest & Woodland|1.9. Subtropical/Tropic…3. Shrubland | 3.5. Subtropical/Tropical Dry…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 19.2–26.0

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 23.9–28.7

Min temp (night)20.7 °C 15.7–23.7

Precipitation83.3 mm/mo 53.2–265

Air humidity65.6 % 59.3–69.3

Moisture balance-44.1 mm/mo -108–97.0

Vapour deficit919 Pa 755–1,221

Wind speed2.30 m/s 2.10–3.70

Cloud cover21.8 % 13.7–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 70 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)